Incidental Mutation 'PIT4791001:Tm7sf2'
ID556992
Institutional Source Beutler Lab
Gene Symbol Tm7sf2
Ensembl Gene ENSMUSG00000024799
Gene Nametransmembrane 7 superfamily member 2
Synonyms3110041O18Rik, ANG1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4791001 (G1)
Quality Score196.009
Status Not validated
Chromosome19
Chromosomal Location6062821-6077197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6063605 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 299 (I299V)
Ref Sequence ENSEMBL: ENSMUSP00000025713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025711] [ENSMUST00000025713] [ENSMUST00000043074] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000159832] [ENSMUST00000160028] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000161718] [ENSMUST00000162575] [ENSMUST00000162726] [ENSMUST00000162810] [ENSMUST00000178310] [ENSMUST00000179142]
Predicted Effect probably benign
Transcript: ENSMUST00000025711
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025713
AA Change: I299V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799
AA Change: I299V

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043074
SMART Domains Protein: ENSMUSP00000042835
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 133 9.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113543
AA Change: I299V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799
AA Change: I299V

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159084
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159475
Predicted Effect probably benign
Transcript: ENSMUST00000159832
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160028
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161090
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161528
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161718
AA Change: I99V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799
AA Change: I99V

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162575
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162726
SMART Domains Protein: ENSMUSP00000134031
Gene: ENSMUSG00000075227

DomainStartEndE-ValueType
Pfam:zf-HIT 3 36 2e-15 PFAM
low complexity region 54 97 N/A INTRINSIC
low complexity region 120 140 N/A INTRINSIC
low complexity region 167 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178310
SMART Domains Protein: ENSMUSP00000136803
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 133 9.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179142
SMART Domains Protein: ENSMUSP00000136358
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 132 6.7e-34 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Dstyk A G 1: 132,449,927 T424A probably benign Het
Gabrr3 A G 16: 59,429,935 probably null Het
Gnai3 A G 3: 108,118,305 S153P probably benign Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Myof A T 19: 37,982,958 probably null Het
Nrxn1 T C 17: 90,455,503 probably benign Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Olfr1107 A T 2: 87,071,702 M144K possibly damaging Het
Pkdcc C T 17: 83,220,148 R252* probably null Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tnks1bp1 A G 2: 85,062,558 E943G probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Vmo1 A C 11: 70,513,835 C113W probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Tm7sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Tm7sf2 APN 19 6063568 missense probably damaging 1.00
IGL03299:Tm7sf2 APN 19 6062928 missense probably benign 0.03
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R1607:Tm7sf2 UTSW 19 6063019 splice site probably null
R3415:Tm7sf2 UTSW 19 6063599 missense probably damaging 1.00
R5392:Tm7sf2 UTSW 19 6063968 missense probably damaging 1.00
R5835:Tm7sf2 UTSW 19 6063884 missense probably damaging 1.00
R5886:Tm7sf2 UTSW 19 6066542 unclassified probably benign
R6065:Tm7sf2 UTSW 19 6063386 missense possibly damaging 0.65
R6300:Tm7sf2 UTSW 19 6067200 missense probably damaging 1.00
R6915:Tm7sf2 UTSW 19 6068312 missense probably damaging 0.99
R7037:Tm7sf2 UTSW 19 6064077 critical splice donor site probably null
R7073:Tm7sf2 UTSW 19 6066497 critical splice donor site probably null
R7328:Tm7sf2 UTSW 19 6064126 missense possibly damaging 0.63
R7373:Tm7sf2 UTSW 19 6066646 missense probably benign 0.39
R7612:Tm7sf2 UTSW 19 6070608 missense probably benign 0.08
R7779:Tm7sf2 UTSW 19 6062917 missense possibly damaging 0.95
R7903:Tm7sf2 UTSW 19 6071335 missense probably damaging 1.00
R7904:Tm7sf2 UTSW 19 6068912 missense probably damaging 0.96
R8082:Tm7sf2 UTSW 19 6066321 missense probably damaging 1.00
R8155:Tm7sf2 UTSW 19 6064095 missense probably damaging 1.00
R8428:Tm7sf2 UTSW 19 6063044 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCGGGATGGTCTCAAGAC -3'
(R):5'- CTGCCTCCTTAAGGGTCAGTAG -3'

Sequencing Primer
(F):5'- CCTAGAAATACAGCTAATGAAACGG -3'
(R):5'- CAGTAGGAGGGCCCTTCATTTC -3'
Posted On2019-06-07