Incidental Mutation 'R6509:Map3k1'
ID519873
Institutional Source Beutler Lab
Gene Symbol Map3k1
Ensembl Gene ENSMUSG00000021754
Gene Namemitogen-activated protein kinase kinase kinase 1
SynonymsMekk, MEKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R6509 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location111746428-111808993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111753829 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1279 (M1279L)
Ref Sequence ENSEMBL: ENSMUSP00000104890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109267]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109267
AA Change: M1279L

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: M1279L

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 85 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
Pfam:SWIM 333 361 3.1e-7 PFAM
low complexity region 417 426 N/A INTRINSIC
RING 438 486 2.69e-1 SMART
low complexity region 512 527 N/A INTRINSIC
low complexity region 596 625 N/A INTRINSIC
low complexity region 750 762 N/A INTRINSIC
low complexity region 967 978 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
S_TKc 1224 1489 9.58e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175936
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,329,397 T15I probably benign Het
4930522L14Rik G A 5: 109,737,384 R203* probably null Het
Ccnc A G 4: 21,740,642 N133D probably benign Het
Lbhd2 A G 12: 111,410,313 R65G possibly damaging Het
Lrrc37a A G 11: 103,504,414 S62P probably benign Het
Ncapg2 G A 12: 116,427,756 R475Q probably damaging Het
Nlrp5 A T 7: 23,417,916 N355I probably damaging Het
Olfr847 A G 9: 19,375,143 V246A probably benign Het
Pdzd8 A G 19: 59,344,866 F241S probably benign Het
Rgl3 A G 9: 21,971,908 S705P probably benign Het
Rsbn1 A G 3: 103,960,032 Y563C probably damaging Het
Sept9 A G 11: 117,290,427 I18V probably benign Het
Sycp2 G A 2: 178,395,894 P153S probably damaging Het
Tbc1d4 C A 14: 101,608,318 R48L possibly damaging Het
Vmn1r195 G A 13: 22,279,109 G250R probably benign Het
Vmn2r66 G T 7: 85,006,846 P321T probably benign Het
Other mutations in Map3k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Map3k1 APN 13 111758189 critical splice acceptor site probably null
IGL01686:Map3k1 APN 13 111754662 missense possibly damaging 0.51
IGL02104:Map3k1 APN 13 111756243 missense probably damaging 0.99
IGL03071:Map3k1 APN 13 111755525 missense possibly damaging 0.77
IGL03087:Map3k1 APN 13 111749025 missense probably benign 0.01
IGL03213:Map3k1 APN 13 111748892 utr 3 prime probably benign
Nepal UTSW 13 111752449 missense probably benign 0.07
Snow_leopard UTSW 13 111755764 nonsense probably null
R0005:Map3k1 UTSW 13 111755704 missense probably benign 0.00
R0025:Map3k1 UTSW 13 111756129 missense probably benign
R0506:Map3k1 UTSW 13 111755764 nonsense probably null
R0540:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0607:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0898:Map3k1 UTSW 13 111767956 unclassified probably benign
R1171:Map3k1 UTSW 13 111755643 missense probably benign 0.29
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1682:Map3k1 UTSW 13 111757150 missense probably damaging 1.00
R1718:Map3k1 UTSW 13 111755419 missense probably benign 0.23
R1893:Map3k1 UTSW 13 111768033 missense possibly damaging 0.91
R2174:Map3k1 UTSW 13 111752482 missense possibly damaging 0.75
R2215:Map3k1 UTSW 13 111755788 missense probably benign 0.00
R2239:Map3k1 UTSW 13 111748944 missense probably benign 0.00
R3686:Map3k1 UTSW 13 111753891 missense probably damaging 0.99
R3783:Map3k1 UTSW 13 111756220 missense probably benign 0.00
R4094:Map3k1 UTSW 13 111756162 missense possibly damaging 0.48
R4231:Map3k1 UTSW 13 111768494 missense probably benign 0.01
R4902:Map3k1 UTSW 13 111772612 missense probably damaging 0.99
R4967:Map3k1 UTSW 13 111772738 missense probably damaging 0.96
R5465:Map3k1 UTSW 13 111756120 missense probably benign 0.20
R5855:Map3k1 UTSW 13 111755979 missense probably benign 0.37
R6384:Map3k1 UTSW 13 111750530 missense probably damaging 1.00
R6389:Map3k1 UTSW 13 111769441 missense probably damaging 1.00
R6400:Map3k1 UTSW 13 111755725 missense probably damaging 0.99
R6644:Map3k1 UTSW 13 111752449 missense probably benign 0.07
R6900:Map3k1 UTSW 13 111753816 missense probably benign 0.01
R6943:Map3k1 UTSW 13 111772712 missense probably benign 0.30
R6946:Map3k1 UTSW 13 111768501 nonsense probably null
R7059:Map3k1 UTSW 13 111772778 missense probably benign
R7271:Map3k1 UTSW 13 111756697 missense probably benign 0.32
R7290:Map3k1 UTSW 13 111768111 missense probably damaging 1.00
R7397:Map3k1 UTSW 13 111755208 missense probably damaging 0.98
R7457:Map3k1 UTSW 13 111756255 missense probably damaging 0.99
R7827:Map3k1 UTSW 13 111756129 missense probably benign
R7990:Map3k1 UTSW 13 111756162 missense probably benign 0.28
R8110:Map3k1 UTSW 13 111755313 missense probably damaging 0.98
R8119:Map3k1 UTSW 13 111772622 missense possibly damaging 0.89
R8179:Map3k1 UTSW 13 111749047 missense probably damaging 1.00
R8317:Map3k1 UTSW 13 111758162 missense probably damaging 1.00
R8397:Map3k1 UTSW 13 111755604 missense probably damaging 0.99
X0065:Map3k1 UTSW 13 111757105 missense probably damaging 1.00
Z1177:Map3k1 UTSW 13 111755946 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGACCTAAAGTATTCATAAGTGAAGC -3'
(R):5'- TGACTCGTCTTCCATGTTGAG -3'

Sequencing Primer
(F):5'- CATCTAGTCACTTGTGTGTAAGCAG -3'
(R):5'- AGGGTAAATGCCATTTGCTGCC -3'
Posted On2018-06-06