Mutagenetix > Incidental Mutation

Incidental Mutation 'R6509:Map3k1'

519873

Institutional Source

Beutler Lab

Gene Symbol

Map3k1

Ensembl Gene

ENSMUSG00000021754

Gene Name

mitogen-activated protein kinase kinase kinase 1

Synonyms

MEKK1, Mekk

MMRRC Submission

044422-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.909) question?

Stock #

R6509 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

111882962-111945527 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 111890363 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1279 (M1279L)

Ref Sequence

ENSEMBL: ENSMUSP00000104890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109267]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109267
AA Change: M1279L

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: M1279L

Domain	Start	End	E-Value	Type
low complexity region	2	46	N/A	INTRINSIC
low complexity region	85	101	N/A	INTRINSIC
low complexity region	112	122	N/A	INTRINSIC
low complexity region	138	158	N/A	INTRINSIC
low complexity region	235	256	N/A	INTRINSIC
Pfam:SWIM	333	361	3.1e-7	PFAM
low complexity region	417	426	N/A	INTRINSIC
RING	438	486	2.69e-1	SMART
low complexity region	512	527	N/A	INTRINSIC
low complexity region	596	625	N/A	INTRINSIC
low complexity region	750	762	N/A	INTRINSIC
low complexity region	967	978	N/A	INTRINSIC
low complexity region	1073	1084	N/A	INTRINSIC
low complexity region	1160	1178	N/A	INTRINSIC
S_TKc	1224	1489	9.58e-85	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130594

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175936

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	G	A	5: 109,885,250 (GRCm39)	R203*	probably null	Het
Ccnc	A	G	4: 21,740,642 (GRCm39)	N133D	probably benign	Het
Cfap299	C	T	5: 98,477,256 (GRCm39)	T15I	probably benign	Het
Lbhd2	A	G	12: 111,376,747 (GRCm39)	R65G	possibly damaging	Het
Lrrc37a	A	G	11: 103,395,240 (GRCm39)	S62P	probably benign	Het
Ncapg2	G	A	12: 116,391,376 (GRCm39)	R475Q	probably damaging	Het
Nlrp5	A	T	7: 23,117,341 (GRCm39)	N355I	probably damaging	Het
Or7g29	A	G	9: 19,286,439 (GRCm39)	V246A	probably benign	Het
Pdzd8	A	G	19: 59,333,298 (GRCm39)	F241S	probably benign	Het
Rgl3	A	G	9: 21,883,204 (GRCm39)	S705P	probably benign	Het
Rsbn1	A	G	3: 103,867,348 (GRCm39)	Y563C	probably damaging	Het
Septin9	A	G	11: 117,181,253 (GRCm39)	I18V	probably benign	Het
Sycp2	G	A	2: 178,037,687 (GRCm39)	P153S	probably damaging	Het
Tbc1d4	C	A	14: 101,845,754 (GRCm39)	R48L	possibly damaging	Het
Vmn1r195	G	A	13: 22,463,279 (GRCm39)	G250R	probably benign	Het
Vmn2r66	G	T	7: 84,656,054 (GRCm39)	P321T	probably benign	Het

Other mutations in Map3k1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01594:Map3k1	APN	13	111,894,723 (GRCm39)	critical splice acceptor site	probably null
IGL01686:Map3k1	APN	13	111,891,196 (GRCm39)	missense	possibly damaging	0.51
IGL02104:Map3k1	APN	13	111,892,777 (GRCm39)	missense	probably damaging	0.99
IGL03071:Map3k1	APN	13	111,892,059 (GRCm39)	missense	possibly damaging	0.77
IGL03087:Map3k1	APN	13	111,885,559 (GRCm39)	missense	probably benign	0.01
IGL03213:Map3k1	APN	13	111,885,426 (GRCm39)	utr 3 prime	probably benign
Nepal	UTSW	13	111,888,983 (GRCm39)	missense	probably benign	0.07
Snow_leopard	UTSW	13	111,892,298 (GRCm39)	nonsense	probably null
R0005:Map3k1	UTSW	13	111,892,238 (GRCm39)	missense	probably benign	0.00
R0025:Map3k1	UTSW	13	111,892,663 (GRCm39)	missense	probably benign
R0506:Map3k1	UTSW	13	111,892,298 (GRCm39)	nonsense	probably null
R0540:Map3k1	UTSW	13	111,900,044 (GRCm39)	missense	probably benign	0.05
R0607:Map3k1	UTSW	13	111,900,044 (GRCm39)	missense	probably benign	0.05
R0898:Map3k1	UTSW	13	111,904,490 (GRCm39)	unclassified	probably benign
R1171:Map3k1	UTSW	13	111,892,177 (GRCm39)	missense	probably benign	0.29
R1464:Map3k1	UTSW	13	111,892,405 (GRCm39)	missense	possibly damaging	0.67
R1464:Map3k1	UTSW	13	111,892,405 (GRCm39)	missense	possibly damaging	0.67
R1682:Map3k1	UTSW	13	111,893,684 (GRCm39)	missense	probably damaging	1.00
R1718:Map3k1	UTSW	13	111,891,953 (GRCm39)	missense	probably benign	0.23
R1893:Map3k1	UTSW	13	111,904,567 (GRCm39)	missense	possibly damaging	0.91
R2174:Map3k1	UTSW	13	111,889,016 (GRCm39)	missense	possibly damaging	0.75
R2215:Map3k1	UTSW	13	111,892,322 (GRCm39)	missense	probably benign	0.00
R2239:Map3k1	UTSW	13	111,885,478 (GRCm39)	missense	probably benign	0.00
R3686:Map3k1	UTSW	13	111,890,425 (GRCm39)	missense	probably damaging	0.99
R3783:Map3k1	UTSW	13	111,892,754 (GRCm39)	missense	probably benign	0.00
R4094:Map3k1	UTSW	13	111,892,696 (GRCm39)	missense	possibly damaging	0.48
R4231:Map3k1	UTSW	13	111,905,028 (GRCm39)	missense	probably benign	0.01
R4902:Map3k1	UTSW	13	111,909,146 (GRCm39)	missense	probably damaging	0.99
R4967:Map3k1	UTSW	13	111,909,272 (GRCm39)	missense	probably damaging	0.96
R5465:Map3k1	UTSW	13	111,892,654 (GRCm39)	missense	probably benign	0.20
R5855:Map3k1	UTSW	13	111,892,513 (GRCm39)	missense	probably benign	0.37
R6384:Map3k1	UTSW	13	111,887,064 (GRCm39)	missense	probably damaging	1.00
R6389:Map3k1	UTSW	13	111,905,975 (GRCm39)	missense	probably damaging	1.00
R6400:Map3k1	UTSW	13	111,892,259 (GRCm39)	missense	probably damaging	0.99
R6644:Map3k1	UTSW	13	111,888,983 (GRCm39)	missense	probably benign	0.07
R6900:Map3k1	UTSW	13	111,890,350 (GRCm39)	missense	probably benign	0.01
R6943:Map3k1	UTSW	13	111,909,246 (GRCm39)	missense	probably benign	0.30
R6946:Map3k1	UTSW	13	111,905,035 (GRCm39)	nonsense	probably null
R7059:Map3k1	UTSW	13	111,909,312 (GRCm39)	missense	probably benign
R7271:Map3k1	UTSW	13	111,893,231 (GRCm39)	missense	probably benign	0.32
R7290:Map3k1	UTSW	13	111,904,645 (GRCm39)	missense	probably damaging	1.00
R7397:Map3k1	UTSW	13	111,891,742 (GRCm39)	missense	probably damaging	0.98
R7457:Map3k1	UTSW	13	111,892,789 (GRCm39)	missense	probably damaging	0.99
R7827:Map3k1	UTSW	13	111,892,663 (GRCm39)	missense	probably benign
R7990:Map3k1	UTSW	13	111,892,696 (GRCm39)	missense	probably benign	0.28
R8110:Map3k1	UTSW	13	111,891,847 (GRCm39)	missense	probably damaging	0.98
R8119:Map3k1	UTSW	13	111,909,156 (GRCm39)	missense	possibly damaging	0.89
R8179:Map3k1	UTSW	13	111,885,581 (GRCm39)	missense	probably damaging	1.00
R8317:Map3k1	UTSW	13	111,894,696 (GRCm39)	missense	probably damaging	1.00
R8397:Map3k1	UTSW	13	111,892,138 (GRCm39)	missense	probably damaging	0.99
R8745:Map3k1	UTSW	13	111,893,306 (GRCm39)	missense	probably damaging	1.00
R8829:Map3k1	UTSW	13	111,889,015 (GRCm39)	missense	possibly damaging	0.88
R8832:Map3k1	UTSW	13	111,889,015 (GRCm39)	missense	possibly damaging	0.88
R8939:Map3k1	UTSW	13	111,892,837 (GRCm39)	nonsense	probably null
R9640:Map3k1	UTSW	13	111,900,699 (GRCm39)	nonsense	probably null
R9649:Map3k1	UTSW	13	111,885,478 (GRCm39)	missense	probably damaging	0.97
R9653:Map3k1	UTSW	13	111,890,296 (GRCm39)	missense	possibly damaging	0.94
R9763:Map3k1	UTSW	13	111,912,499 (GRCm39)	missense	probably damaging	1.00
R9768:Map3k1	UTSW	13	111,904,630 (GRCm39)	missense	probably benign	0.04
X0065:Map3k1	UTSW	13	111,893,639 (GRCm39)	missense	probably damaging	1.00
Z1177:Map3k1	UTSW	13	111,892,480 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGACCTAAAGTATTCATAAGTGAAGC -3'
(R):5'- TGACTCGTCTTCCATGTTGAG -3'

Sequencing Primer
(F):5'- CATCTAGTCACTTGTGTGTAAGCAG -3'
(R):5'- AGGGTAAATGCCATTTGCTGCC -3'

Posted On

2018-06-06