Incidental Mutation 'R8179:Map3k1'
ID634574
Institutional Source Beutler Lab
Gene Symbol Map3k1
Ensembl Gene ENSMUSG00000021754
Gene Namemitogen-activated protein kinase kinase kinase 1
SynonymsMekk, MEKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R8179 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location111746428-111808993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 111749047 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1445 (I1445M)
Ref Sequence ENSEMBL: ENSMUSP00000104890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109267]
Predicted Effect probably damaging
Transcript: ENSMUST00000109267
AA Change: I1445M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: I1445M

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 85 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
Pfam:SWIM 333 361 3.1e-7 PFAM
low complexity region 417 426 N/A INTRINSIC
RING 438 486 2.69e-1 SMART
low complexity region 512 527 N/A INTRINSIC
low complexity region 596 625 N/A INTRINSIC
low complexity region 750 762 N/A INTRINSIC
low complexity region 967 978 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
S_TKc 1224 1489 9.58e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,245,274 Y170H probably damaging Het
Ace3 G T 11: 106,004,557 V602L probably benign Het
Ahr T C 12: 35,510,051 Q201R probably benign Het
Aldh18a1 A C 19: 40,557,508 C612G probably damaging Het
Ankrd40 G A 11: 94,334,715 A191T probably benign Het
Aox1 A G 1: 58,097,958 D1169G probably damaging Het
Arfgap2 T C 2: 91,275,323 F505L probably damaging Het
Arhgap40 T C 2: 158,539,856 F423L probably damaging Het
Atf6b T C 17: 34,653,994 M628T probably damaging Het
Casp8ap2 T A 4: 32,643,939 L1004* probably null Het
Cc2d2a T A 5: 43,699,953 L494Q probably damaging Het
Cd180 T C 13: 102,705,633 S396P probably benign Het
Cdk19 T C 10: 40,394,372 I59T possibly damaging Het
Cfap54 G T 10: 92,997,316 F1149L possibly damaging Het
Chp1 C T 2: 119,547,772 probably benign Het
Clmp T C 9: 40,781,179 F248S probably benign Het
Ctc1 T A 11: 69,024,224 I237K probably benign Het
Ddx54 T A 5: 120,627,102 M812K probably benign Het
Disc1 C T 8: 125,087,577 P60L probably benign Het
Disp2 C G 2: 118,792,549 P1254R probably damaging Het
Dnah11 T A 12: 117,878,549 I4432F possibly damaging Het
Dnajc15 A T 14: 77,852,953 I58N Het
E330021D16Rik A G 6: 136,401,242 S197P probably damaging Het
Elovl5 A G 9: 77,976,899 N159S probably damaging Het
Fgfr3 T C 5: 33,727,755 V71A probably benign Het
Frs2 A T 10: 117,076,886 H167Q probably damaging Het
Gm3286 T C 5: 95,519,894 V111A probably benign Het
Gm4553 A T 7: 142,164,857 V278E unknown Het
Grin2d A T 7: 45,858,028 Y416* probably null Het
Hmcn1 A T 1: 150,722,514 V1679E probably benign Het
Igkv18-36 T C 6: 69,992,495 Y105C probably damaging Het
Lingo1 T C 9: 56,619,850 D491G probably damaging Het
Med30 A T 15: 52,712,568 Q20L probably damaging Het
Mgat5b A G 11: 116,931,728 E96G probably benign Het
Mmp16 T A 4: 17,853,854 probably null Het
Mogat1 A G 1: 78,527,618 D176G possibly damaging Het
Mre11a T A 9: 14,797,066 D142E probably null Het
Mybpc2 C A 7: 44,509,830 V599L probably benign Het
Myot A T 18: 44,354,130 R345* probably null Het
Olfr419 T G 1: 174,250,564 D121A possibly damaging Het
Olfr968 C T 9: 39,771,904 V299I probably benign Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pglyrp2 T C 17: 32,416,029 Y453C possibly damaging Het
Phrf1 A G 7: 141,256,580 Y255C unknown Het
Plppr4 A G 3: 117,331,678 S171P probably damaging Het
Ppip5k1 A T 2: 121,341,614 probably null Het
Rapgef3 A T 15: 97,760,740 H170Q probably benign Het
Rnf10 ACCTCATCTCGTC AC 5: 115,260,117 probably null Het
Rpe65 A G 3: 159,624,699 Y501C probably benign Het
Ruvbl2 A G 7: 45,422,772 I346T probably damaging Het
Sema3g A G 14: 31,220,585 I48V probably benign Het
Slc4a10 A C 2: 62,243,448 S285R possibly damaging Het
Slc6a11 G A 6: 114,245,606 G521S probably benign Het
Slit3 A G 11: 35,664,076 N912D probably benign Het
Traf3ip1 T C 1: 91,500,801 V128A unknown Het
Trpc7 T A 13: 56,887,880 N80I probably damaging Het
Ttc21b G A 2: 66,201,480 H1031Y probably benign Het
Tubg2 A T 11: 101,160,256 I235F probably benign Het
Vmn2r118 A T 17: 55,608,484 Y489N probably benign Het
Vmn2r54 G T 7: 12,632,091 C305* probably null Het
Vmn2r86 G A 10: 130,453,084 H183Y probably benign Het
Vprbp G T 9: 106,857,916 V688L probably damaging Het
Xrcc5 T C 1: 72,356,857 V603A probably damaging Het
Zfp110 T A 7: 12,844,571 Y136* probably null Het
Zfp112 C T 7: 24,125,638 P348S probably benign Het
Other mutations in Map3k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Map3k1 APN 13 111758189 critical splice acceptor site probably null
IGL01686:Map3k1 APN 13 111754662 missense possibly damaging 0.51
IGL02104:Map3k1 APN 13 111756243 missense probably damaging 0.99
IGL03071:Map3k1 APN 13 111755525 missense possibly damaging 0.77
IGL03087:Map3k1 APN 13 111749025 missense probably benign 0.01
IGL03213:Map3k1 APN 13 111748892 utr 3 prime probably benign
Nepal UTSW 13 111752449 missense probably benign 0.07
Snow_leopard UTSW 13 111755764 nonsense probably null
R0005:Map3k1 UTSW 13 111755704 missense probably benign 0.00
R0025:Map3k1 UTSW 13 111756129 missense probably benign
R0506:Map3k1 UTSW 13 111755764 nonsense probably null
R0540:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0607:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0898:Map3k1 UTSW 13 111767956 unclassified probably benign
R1171:Map3k1 UTSW 13 111755643 missense probably benign 0.29
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1682:Map3k1 UTSW 13 111757150 missense probably damaging 1.00
R1718:Map3k1 UTSW 13 111755419 missense probably benign 0.23
R1893:Map3k1 UTSW 13 111768033 missense possibly damaging 0.91
R2174:Map3k1 UTSW 13 111752482 missense possibly damaging 0.75
R2215:Map3k1 UTSW 13 111755788 missense probably benign 0.00
R2239:Map3k1 UTSW 13 111748944 missense probably benign 0.00
R3686:Map3k1 UTSW 13 111753891 missense probably damaging 0.99
R3783:Map3k1 UTSW 13 111756220 missense probably benign 0.00
R4094:Map3k1 UTSW 13 111756162 missense possibly damaging 0.48
R4231:Map3k1 UTSW 13 111768494 missense probably benign 0.01
R4902:Map3k1 UTSW 13 111772612 missense probably damaging 0.99
R4967:Map3k1 UTSW 13 111772738 missense probably damaging 0.96
R5465:Map3k1 UTSW 13 111756120 missense probably benign 0.20
R5855:Map3k1 UTSW 13 111755979 missense probably benign 0.37
R6384:Map3k1 UTSW 13 111750530 missense probably damaging 1.00
R6389:Map3k1 UTSW 13 111769441 missense probably damaging 1.00
R6400:Map3k1 UTSW 13 111755725 missense probably damaging 0.99
R6509:Map3k1 UTSW 13 111753829 missense possibly damaging 0.48
R6644:Map3k1 UTSW 13 111752449 missense probably benign 0.07
R6900:Map3k1 UTSW 13 111753816 missense probably benign 0.01
R6943:Map3k1 UTSW 13 111772712 missense probably benign 0.30
R6946:Map3k1 UTSW 13 111768501 nonsense probably null
R7059:Map3k1 UTSW 13 111772778 missense probably benign
R7271:Map3k1 UTSW 13 111756697 missense probably benign 0.32
R7290:Map3k1 UTSW 13 111768111 missense probably damaging 1.00
R7397:Map3k1 UTSW 13 111755208 missense probably damaging 0.98
R7457:Map3k1 UTSW 13 111756255 missense probably damaging 0.99
R7827:Map3k1 UTSW 13 111756129 missense probably benign
R7990:Map3k1 UTSW 13 111756162 missense probably benign 0.28
R8110:Map3k1 UTSW 13 111755313 missense probably damaging 0.98
R8119:Map3k1 UTSW 13 111772622 missense possibly damaging 0.89
R8317:Map3k1 UTSW 13 111758162 missense probably damaging 1.00
R8397:Map3k1 UTSW 13 111755604 missense probably damaging 0.99
X0065:Map3k1 UTSW 13 111757105 missense probably damaging 1.00
Z1177:Map3k1 UTSW 13 111755946 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGTCGCCCACAAGTTCTC -3'
(R):5'- GATTCATCCTTTACCTGTTTATGGG -3'

Sequencing Primer
(F):5'- GTTGCATATCCTGTCTCCATTAGAG -3'
(R):5'- CTGTAATTGAAGTACTCCCGAAGTGG -3'
Posted On2020-07-13