Incidental Mutation 'R6630:Map1s'
ID525056
Institutional Source Beutler Lab
Gene Symbol Map1s
Ensembl Gene ENSMUSG00000019261
Gene Namemicrotubule-associated protein 1S
SynonymsBpy2ip1, Map8, VCY2IP1, 6430517J16Rik, Mtap1s
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6630 (G1)
Quality Score137.008
Status Not validated
Chromosome8
Chromosomal Location70905932-70917529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70913798 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 449 (V449A)
Ref Sequence ENSEMBL: ENSMUSP00000148554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019405] [ENSMUST00000211910] [ENSMUST00000212227] [ENSMUST00000212511] [ENSMUST00000213001]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019405
AA Change: V449A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019405
Gene: ENSMUSG00000019261
AA Change: V449A

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 125 137 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
SCOP:d1e5da2 237 300 2e-3 SMART
Blast:Lactamase_B 244 475 1e-85 BLAST
low complexity region 536 550 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
low complexity region 715 734 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
low complexity region 774 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211880
Predicted Effect probably benign
Transcript: ENSMUST00000211910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212143
Predicted Effect probably damaging
Transcript: ENSMUST00000212227
AA Change: V449A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212697
Predicted Effect probably benign
Transcript: ENSMUST00000213001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213083
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective biogenesis and degradation of autophagosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,287,072 M3368K possibly damaging Het
A4gnt A G 9: 99,613,918 T136A probably benign Het
Calb1 T A 4: 15,885,637 D69E probably benign Het
Cecr2 A T 6: 120,762,178 N1261Y probably damaging Het
Cenpo G A 12: 4,217,236 probably benign Het
Cep131 A G 11: 120,073,815 W272R probably damaging Het
Cnr1 T A 4: 33,944,659 I349N probably damaging Het
Dcst1 A T 3: 89,364,326 I50K possibly damaging Het
Dhh C T 15: 98,894,366 V254M possibly damaging Het
Dhrs9 G T 2: 69,397,723 W227L possibly damaging Het
Gm15292 T A 8: 21,249,888 S43T probably damaging Het
Heca G A 10: 17,908,108 R104* probably null Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Mapk1 A G 16: 17,026,385 D7G probably damaging Het
Mapre3 G T 5: 30,862,542 V56F probably damaging Het
Mepce G A 5: 137,784,921 T381I probably benign Het
Mga T A 2: 119,923,659 V804E probably damaging Het
Myh6 T C 14: 54,942,001 K157E probably benign Het
Olfr393 T A 11: 73,847,876 H83L probably benign Het
Palb2 A T 7: 122,124,529 S303T probably damaging Het
Phc2 C A 4: 128,723,630 P483Q probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp4r3a A G 12: 101,049,776 L39S probably damaging Het
Samsn1 G A 16: 75,879,204 A101V probably benign Het
Tmem2 A G 19: 21,852,229 N1234S probably damaging Het
Trbv3 T A 6: 41,048,572 I32K possibly damaging Het
Trpm3 A T 19: 22,987,983 N1614I probably benign Het
Ubr2 T C 17: 46,951,984 R1234G possibly damaging Het
Usp24 T C 4: 106,387,835 S1291P possibly damaging Het
Vmn1r81 A T 7: 12,260,657 L8* probably null Het
Vmn2r24 T A 6: 123,787,022 I286N probably benign Het
Other mutations in Map1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Map1s APN 8 70906029 unclassified probably benign
IGL01012:Map1s APN 8 70913910 missense probably benign 0.00
IGL01729:Map1s APN 8 70913068 missense probably damaging 1.00
IGL03158:Map1s APN 8 70914734 missense probably damaging 0.97
E0374:Map1s UTSW 8 70906017 unclassified probably benign
R0026:Map1s UTSW 8 70914638 missense probably damaging 1.00
R0172:Map1s UTSW 8 70914968 missense probably benign 0.00
R0571:Map1s UTSW 8 70912907 missense probably damaging 1.00
R0666:Map1s UTSW 8 70914052 missense possibly damaging 0.88
R0904:Map1s UTSW 8 70914188 missense probably damaging 0.96
R1617:Map1s UTSW 8 70913451 missense probably damaging 1.00
R1834:Map1s UTSW 8 70916411 missense probably damaging 0.97
R2134:Map1s UTSW 8 70913882 missense probably benign 0.00
R2143:Map1s UTSW 8 70910964 missense probably damaging 1.00
R3413:Map1s UTSW 8 70912519 missense probably damaging 0.99
R3870:Map1s UTSW 8 70917101 missense possibly damaging 0.82
R5555:Map1s UTSW 8 70917107 missense probably damaging 0.97
R5784:Map1s UTSW 8 70914358 missense probably damaging 1.00
R7379:Map1s UTSW 8 70913575 missense possibly damaging 0.87
R7569:Map1s UTSW 8 70913498 missense probably benign 0.05
Z1088:Map1s UTSW 8 70916449 missense possibly damaging 0.66
Z1177:Map1s UTSW 8 70914517 missense not run
Predicted Primers PCR Primer
(F):5'- TTTCGAGAAGCTGGGCGTAG -3'
(R):5'- CGAGGCTTTGTGTTGACCAC -3'

Sequencing Primer
(F):5'- AGAGCTTTTTGTGCTGCACC -3'
(R):5'- CTGAGTGGGCCCAGATCTTG -3'
Posted On2018-06-22