Incidental Mutation 'R0172:Map1s'
ID24276
Institutional Source Beutler Lab
Gene Symbol Map1s
Ensembl Gene ENSMUSG00000019261
Gene Namemicrotubule-associated protein 1S
SynonymsBpy2ip1, Map8, VCY2IP1, 6430517J16Rik, Mtap1s
MMRRC Submission 038444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0172 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location70905932-70917529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70914968 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 839 (M839K)
Ref Sequence ENSEMBL: ENSMUSP00000148554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019405] [ENSMUST00000211910] [ENSMUST00000212227] [ENSMUST00000212511] [ENSMUST00000213001]
Predicted Effect probably benign
Transcript: ENSMUST00000019405
AA Change: M839K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019405
Gene: ENSMUSG00000019261
AA Change: M839K

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 125 137 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
SCOP:d1e5da2 237 300 2e-3 SMART
Blast:Lactamase_B 244 475 1e-85 BLAST
low complexity region 536 550 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
low complexity region 715 734 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
low complexity region 774 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211880
Predicted Effect probably benign
Transcript: ENSMUST00000211910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212143
Predicted Effect probably benign
Transcript: ENSMUST00000212227
AA Change: M839K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000212511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212697
Predicted Effect probably benign
Transcript: ENSMUST00000213001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213083
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective biogenesis and degradation of autophagosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Acp7 T C 7: 28,615,124 N272S possibly damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Ap1m2 A T 9: 21,298,332 probably null Het
Atp12a T C 14: 56,372,844 V224A probably damaging Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Cep350 T C 1: 155,953,447 N237S probably benign Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
Exosc10 T C 4: 148,565,357 S415P probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hip1r T A 5: 123,996,940 Y380N possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lipg G T 18: 74,948,174 H279N possibly damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Slc22a27 C A 19: 7,865,836 G393* probably null Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Map1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Map1s APN 8 70906029 unclassified probably benign
IGL01012:Map1s APN 8 70913910 missense probably benign 0.00
IGL01729:Map1s APN 8 70913068 missense probably damaging 1.00
IGL03158:Map1s APN 8 70914734 missense probably damaging 0.97
E0374:Map1s UTSW 8 70906017 unclassified probably benign
R0026:Map1s UTSW 8 70914638 missense probably damaging 1.00
R0571:Map1s UTSW 8 70912907 missense probably damaging 1.00
R0666:Map1s UTSW 8 70914052 missense possibly damaging 0.88
R0904:Map1s UTSW 8 70914188 missense probably damaging 0.96
R1617:Map1s UTSW 8 70913451 missense probably damaging 1.00
R1834:Map1s UTSW 8 70916411 missense probably damaging 0.97
R2134:Map1s UTSW 8 70913882 missense probably benign 0.00
R2143:Map1s UTSW 8 70910964 missense probably damaging 1.00
R3413:Map1s UTSW 8 70912519 missense probably damaging 0.99
R3870:Map1s UTSW 8 70917101 missense possibly damaging 0.82
R5555:Map1s UTSW 8 70917107 missense probably damaging 0.97
R5784:Map1s UTSW 8 70914358 missense probably damaging 1.00
R6630:Map1s UTSW 8 70913798 missense probably damaging 1.00
R7379:Map1s UTSW 8 70913575 missense possibly damaging 0.87
R7569:Map1s UTSW 8 70913498 missense probably benign 0.05
Z1088:Map1s UTSW 8 70916449 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTCTGATGATGACGCAGGCAGC -3'
(R):5'- TGGTGGACAGGACGGACTACAC -3'

Sequencing Primer
(F):5'- TGCCAGATGTACCAGGAATC -3'
(R):5'- TGTCAGCAATACCCAGCG -3'
Posted On2013-04-16