Incidental Mutation 'R6607:Dut'
ID525725
Institutional Source Beutler Lab
Gene Symbol Dut
Ensembl Gene ENSMUSG00000027203
Gene Namedeoxyuridine triphosphatase
SynonymsDutp, dUTPase, 5031412I06Rik, D2Bwg0749e, 5133400F09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location125247190-125258608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125256867 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 140 (D140G)
Ref Sequence ENSEMBL: ENSMUSP00000080767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051605] [ENSMUST00000082122]
Predicted Effect probably damaging
Transcript: ENSMUST00000051605
AA Change: D102G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057854
Gene: ENSMUSG00000027203
AA Change: D102G

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:dUTPase 31 160 1.2e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082122
AA Change: D140G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080767
Gene: ENSMUSG00000027203
AA Change: D140G

DomainStartEndE-ValueType
low complexity region 3 56 N/A INTRINSIC
Pfam:dUTPase 69 198 1.6e-52 PFAM
Meta Mutation Damage Score 0.8806 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential enzyme of nucleotide metabolism. The encoded protein forms a ubiquitous, homotetrameric enzyme that hydrolyzes dUTP to dUMP and pyrophosphate. This reaction serves two cellular purposes: providing a precursor (dUMP) for the synthesis of thymine nucleotides needed for DNA replication, and limiting intracellular pools of dUTP. Elevated levels of dUTP lead to increased incorporation of uracil into DNA, which induces extensive excision repair mediated by uracil glycosylase. This repair process, resulting in the removal and reincorporation of dUTP, is self-defeating and leads to DNA fragmentation and cell death. Alternative splicing of this gene leads to different isoforms that localize to either the mitochondrion or nucleus. A related pseudogene is located on chromosome 19. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Dut
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Dut UTSW 2 125257091 missense probably damaging 1.00
R1083:Dut UTSW 2 125247828 frame shift probably null
R6446:Dut UTSW 2 125251019 critical splice donor site probably null
R6888:Dut UTSW 2 125257124 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAAATGCTCACCACTTGATAAGC -3'
(R):5'- TACCATCGCTGTGTACTGAC -3'

Sequencing Primer
(F):5'- TGCTCACCACTTGATAAGCATTCAG -3'
(R):5'- GTGTACTGACCCATTTTCTGTAAC -3'
Posted On2018-06-22