Incidental Mutation 'R6607:Cdh4'
ID525727
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Namecadherin 4
SynonymsR-Cadh, Rcad, R-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location179442431-179899373 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 179874096 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 356 (V356I)
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314]
Predicted Effect probably benign
Transcript: ENSMUST00000000314
AA Change: V356I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: V356I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179874144 missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179780403 missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179890884 missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179780474 missense probably benign 0.01
R0082:Cdh4 UTSW 2 179894188 missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179847340 missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179886864 critical splice donor site probably null
R1622:Cdh4 UTSW 2 179889092 missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179797480 missense probably benign 0.01
R1794:Cdh4 UTSW 2 179886842 missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179890847 missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179797524 missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179780367 missense probably benign 0.09
R3861:Cdh4 UTSW 2 179874097 missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179889173 missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179780389 missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179780467 missense probably benign 0.03
R4893:Cdh4 UTSW 2 179847419 intron probably benign
R5029:Cdh4 UTSW 2 179881949 missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179886763 missense probably benign
R5542:Cdh4 UTSW 2 179860226 missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179885996 missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179895767 missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179797626 missense probably damaging 1.00
R6338:Cdh4 UTSW 2 179890812 missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179881996 critical splice donor site probably null
R6653:Cdh4 UTSW 2 179780428 missense probably benign 0.34
R6711:Cdh4 UTSW 2 179890931 missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179847387 missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179860194 missense probably benign 0.19
R6981:Cdh4 UTSW 2 179797504 missense probably benign 0.28
R7285:Cdh4 UTSW 2 179797465 missense probably benign 0.00
R7514:Cdh4 UTSW 2 179890843 missense possibly damaging 0.91
R7541:Cdh4 UTSW 2 179444810 splice site probably null
R7560:Cdh4 UTSW 2 179890902 missense probably benign 0.25
R8146:Cdh4 UTSW 2 179874078 missense possibly damaging 0.91
Z1177:Cdh4 UTSW 2 179780326 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GTGAATGCACCCACTGAAAGC -3'
(R):5'- TCTTCTCCCCACTGAGAGAG -3'

Sequencing Primer
(F):5'- TGCACCCACTGAAAGCTGATG -3'
(R):5'- TCTCCCCACTGAGAGAGAAGGAAG -3'
Posted On2018-06-22