Incidental Mutation 'R6607:Cdh4'
ID 525727
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Name cadherin 4
Synonyms R-Cadh, R-cadherin, Rcad
MMRRC Submission 044730-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6607 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 179084228-179541166 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 179515889 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 356 (V356I)
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314]
AlphaFold P39038
Predicted Effect probably benign
Transcript: ENSMUST00000000314
AA Change: V356I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: V356I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,112,507 (GRCm39) D92G possibly damaging Het
Ace A T 11: 105,863,203 (GRCm39) H326L possibly damaging Het
Adtrp A G 13: 41,931,087 (GRCm39) F167L probably benign Het
Agbl2 A G 2: 90,631,670 (GRCm39) T343A probably damaging Het
Cacna1a A T 8: 85,306,121 (GRCm39) I1290F probably damaging Het
Celsr1 A G 15: 85,847,486 (GRCm39) V1417A probably benign Het
Ctbs A G 3: 146,163,128 (GRCm39) D172G possibly damaging Het
Dnah5 A G 15: 28,445,346 (GRCm39) T4161A possibly damaging Het
Dut A G 2: 125,098,787 (GRCm39) D140G probably damaging Het
Ep400 T C 5: 110,831,180 (GRCm39) D2162G unknown Het
Esyt2 G A 12: 116,332,360 (GRCm39) D781N probably benign Het
Fam174b T C 7: 73,416,312 (GRCm39) L135P probably damaging Het
Fbxo15 A T 18: 84,977,270 (GRCm39) T106S possibly damaging Het
Foxq1 A G 13: 31,743,129 (GRCm39) D77G possibly damaging Het
Gclm G A 3: 122,049,264 (GRCm39) probably null Het
Gcn1 T A 5: 115,747,537 (GRCm39) S1677T probably damaging Het
Hamp2 T A 7: 30,622,013 (GRCm39) R59* probably null Het
Herc1 C T 9: 66,325,849 (GRCm39) A1441V probably benign Het
Lrp1 G A 10: 127,396,005 (GRCm39) H2422Y probably damaging Het
Rbks C T 5: 31,805,136 (GRCm39) V243M possibly damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Homo
Slc17a4 T C 13: 24,089,397 (GRCm39) probably null Het
Slc29a1 A C 17: 45,899,853 (GRCm39) probably null Het
Tenm2 A G 11: 35,954,602 (GRCm39) probably null Het
Tmem26 T A 10: 68,614,543 (GRCm39) H319Q probably benign Het
Vmn1r203 A G 13: 22,708,891 (GRCm39) Y224C probably benign Het
Vmn1r223 T C 13: 23,433,919 (GRCm39) I171T probably damaging Het
Vmn2r101 T C 17: 19,832,296 (GRCm39) L764S probably damaging Het
Vmn2r84 T C 10: 130,226,731 (GRCm39) H369R possibly damaging Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179,515,937 (GRCm39) missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179,422,196 (GRCm39) missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179,532,677 (GRCm39) missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179,422,267 (GRCm39) missense probably benign 0.01
R0082:Cdh4 UTSW 2 179,535,981 (GRCm39) missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179,489,133 (GRCm39) missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179,439,351 (GRCm39) missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179,528,657 (GRCm39) critical splice donor site probably null
R1622:Cdh4 UTSW 2 179,530,885 (GRCm39) missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179,439,273 (GRCm39) missense probably benign 0.01
R1794:Cdh4 UTSW 2 179,528,635 (GRCm39) missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179,532,640 (GRCm39) missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179,439,317 (GRCm39) missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179,422,160 (GRCm39) missense probably benign 0.09
R3861:Cdh4 UTSW 2 179,515,890 (GRCm39) missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179,530,966 (GRCm39) missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179,422,182 (GRCm39) missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179,422,260 (GRCm39) missense probably benign 0.03
R4893:Cdh4 UTSW 2 179,489,212 (GRCm39) intron probably benign
R5029:Cdh4 UTSW 2 179,523,742 (GRCm39) missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179,528,556 (GRCm39) missense probably benign
R5542:Cdh4 UTSW 2 179,502,019 (GRCm39) missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179,527,789 (GRCm39) missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179,537,560 (GRCm39) missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179,439,419 (GRCm39) missense probably damaging 1.00
R6338:Cdh4 UTSW 2 179,532,605 (GRCm39) missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179,523,789 (GRCm39) critical splice donor site probably null
R6653:Cdh4 UTSW 2 179,422,221 (GRCm39) missense probably benign 0.34
R6711:Cdh4 UTSW 2 179,532,724 (GRCm39) missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179,489,180 (GRCm39) missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179,439,351 (GRCm39) missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179,501,987 (GRCm39) missense probably benign 0.19
R6981:Cdh4 UTSW 2 179,439,297 (GRCm39) missense probably benign 0.28
R7285:Cdh4 UTSW 2 179,439,258 (GRCm39) missense probably benign 0.00
R7514:Cdh4 UTSW 2 179,532,636 (GRCm39) missense possibly damaging 0.91
R7541:Cdh4 UTSW 2 179,086,603 (GRCm39) splice site probably null
R7560:Cdh4 UTSW 2 179,532,695 (GRCm39) missense probably benign 0.25
R8146:Cdh4 UTSW 2 179,515,871 (GRCm39) missense possibly damaging 0.91
R8833:Cdh4 UTSW 2 179,535,828 (GRCm39) missense possibly damaging 0.61
R9075:Cdh4 UTSW 2 179,501,940 (GRCm39) missense probably damaging 0.97
R9203:Cdh4 UTSW 2 179,422,196 (GRCm39) missense probably damaging 0.96
Z1177:Cdh4 UTSW 2 179,422,119 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GTGAATGCACCCACTGAAAGC -3'
(R):5'- TCTTCTCCCCACTGAGAGAG -3'

Sequencing Primer
(F):5'- TGCACCCACTGAAAGCTGATG -3'
(R):5'- TCTCCCCACTGAGAGAGAAGGAAG -3'
Posted On 2018-06-22