Incidental Mutation 'R8068:Mns1'
ID 620114
Institutional Source Beutler Lab
Gene Symbol Mns1
Ensembl Gene ENSMUSG00000032221
Gene Name meiosis-specific nuclear structural protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R8068 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 72438011-72462025 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to C at 72448527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034746] [ENSMUST00000183809] [ENSMUST00000184312] [ENSMUST00000184604]
AlphaFold Q61884
Predicted Effect probably null
Transcript: ENSMUST00000034746
SMART Domains Protein: ENSMUSP00000034746
Gene: ENSMUSG00000032221

DomainStartEndE-ValueType
Pfam:TPH 117 462 3.1e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183809
SMART Domains Protein: ENSMUSP00000139105
Gene: ENSMUSG00000032221

DomainStartEndE-ValueType
Pfam:Trichoplein 116 219 5.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184312
SMART Domains Protein: ENSMUSP00000138844
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184604
SMART Domains Protein: ENSMUSP00000139232
Gene: ENSMUSG00000032221

DomainStartEndE-ValueType
Pfam:Trichoplein 116 158 8e-12 PFAM
Pfam:Trichoplein 150 206 1.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein highly similar to the mouse meiosis-specific nuclear structural 1 protein. The mouse protein was shown to be expressed at the pachytene stage during spermatogenesis and may function as a nuclear skeletal protein to regulate nuclear morphology during meiosis. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, male infertility, sperm flagellum abnormalities, immotile sperm, randomized left-right patterning, hydroencephaly, and motile cilia abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T A 8: 40,825,938 D455E not run Het
Aldoc T C 11: 78,324,727 F79S possibly damaging Het
Atmin A G 8: 116,956,650 S350G probably benign Het
Bms1 A G 6: 118,413,750 F206S probably damaging Het
Carmil1 T A 13: 24,075,728 I698L probably benign Het
Cd47 T A 16: 49,895,416 S182T Het
Ces2e G T 8: 104,932,997 probably null Het
Cit C A 5: 115,952,466 H906Q probably damaging Het
Cit T C 5: 115,982,235 S1370P probably benign Het
Dchs2 T C 3: 83,300,438 F1739L probably benign Het
Dlx4 T C 11: 95,145,330 Y51C possibly damaging Het
Drosha T A 15: 12,883,190 Y796* probably null Het
Elf1 T A 14: 79,536,390 F14I probably benign Het
Fam135b T C 15: 71,532,978 Q73R probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gls2 C G 10: 128,195,114 R81G unknown Het
Hnrnpll T C 17: 80,050,852 M157V possibly damaging Het
Itgb3 T A 11: 104,665,511 M726K probably benign Het
Kcna10 T G 3: 107,194,410 M119R possibly damaging Het
Kcnh1 A G 1: 192,241,942 T155A probably benign Het
Kctd9 T A 14: 67,724,662 D51E unknown Het
Lgr6 T C 1: 135,063,664 I129V probably benign Het
Lrrfip1 A T 1: 91,128,102 D598V probably damaging Het
Ltbp4 G T 7: 27,324,168 Q850K probably damaging Het
Mdm1 A G 10: 118,146,804 R115G possibly damaging Het
Mthfs G A 9: 89,211,235 R14Q probably damaging Het
Muc2 T A 7: 141,744,685 S25T Het
Ncapd3 T C 9: 27,063,361 S710P possibly damaging Het
Nrip1 T A 16: 76,292,953 H572L possibly damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1020 A G 2: 85,849,806 E118G probably damaging Het
Olfr1152 A G 2: 87,868,651 Y220C probably benign Het
Olfr656 T A 7: 104,618,253 C191* probably null Het
Opa3 A G 7: 19,244,985 E125G probably damaging Het
P3h1 A G 4: 119,236,862 Y238C probably damaging Het
Pappa2 T C 1: 158,935,985 D652G possibly damaging Het
Pcdha11 T A 18: 37,005,565 N82K probably damaging Het
Pde4b T C 4: 102,596,015 I293T probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Qk T C 17: 10,318,803 D24G possibly damaging Het
Rbpjl A G 2: 164,408,518 K197E possibly damaging Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Scyl1 A G 19: 5,760,825 V488A probably damaging Het
Slc1a6 G C 10: 78,812,872 V476L possibly damaging Het
Slc22a17 A T 14: 54,908,908 F84I probably benign Het
Slc22a4 A C 11: 53,997,443 I253S possibly damaging Het
Speer2 T C 16: 69,860,524 H77R possibly damaging Het
Speg T C 1: 75,422,250 S2114P probably damaging Het
Synpo2 T A 3: 123,117,392 R201S possibly damaging Het
Ttpa C A 4: 20,028,419 H225Q probably damaging Het
Vmn1r45 A T 6: 89,933,279 H236Q possibly damaging Het
Vmn2r7 A T 3: 64,716,086 V271D probably benign Het
Wdr66 A G 5: 123,256,166 S373G not run Het
Zfp53 A T 17: 21,509,012 T436S probably benign Het
Other mutations in Mns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Mns1 APN 9 72456913 unclassified probably benign
R0390:Mns1 UTSW 9 72452804 missense probably damaging 1.00
R0512:Mns1 UTSW 9 72449471 missense possibly damaging 0.87
R1803:Mns1 UTSW 9 72452734 missense probably damaging 1.00
R1988:Mns1 UTSW 9 72448759 splice site probably null
R3821:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R3822:Mns1 UTSW 9 72439448 missense probably damaging 1.00
R4640:Mns1 UTSW 9 72439282 missense probably benign 0.36
R6051:Mns1 UTSW 9 72449453 missense probably damaging 1.00
R6696:Mns1 UTSW 9 72452762 missense probably damaging 1.00
R6835:Mns1 UTSW 9 72452744 missense probably damaging 1.00
R7257:Mns1 UTSW 9 72452815 missense probably damaging 1.00
R7340:Mns1 UTSW 9 72448743 missense probably damaging 1.00
R7903:Mns1 UTSW 9 72452811 missense probably benign 0.04
R9275:Mns1 UTSW 9 72449225 missense probably benign 0.01
R9450:Mns1 UTSW 9 72452608 missense probably benign 0.10
R9786:Mns1 UTSW 9 72439274 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTTATTATCCTTGCCAGGGG -3'
(R):5'- TGAGTTTCTCCTTCAGCAGC -3'

Sequencing Primer
(F):5'- TGTCCTAGGAGCCTCTGGAAAG -3'
(R):5'- GCAGCTGCTCGTATGCCTC -3'
Posted On 2020-01-23