Incidental Mutation 'R6715:Iqcb1'
ID 529307
Institutional Source Beutler Lab
Gene Symbol Iqcb1
Ensembl Gene ENSMUSG00000022837
Gene Name IQ calmodulin-binding motif containing 1
Synonyms 6820449I09Rik, NPHP5
MMRRC Submission 044833-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.266) question?
Stock # R6715 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36648747-36693083 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36655991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 126 (F126S)
Ref Sequence ENSEMBL: ENSMUSP00000110467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023535] [ENSMUST00000075946] [ENSMUST00000114819]
AlphaFold Q8BP00
Predicted Effect probably damaging
Transcript: ENSMUST00000023535
AA Change: F126S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837
AA Change: F126S

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114819
AA Change: F126S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837
AA Change: F126S

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232162
Meta Mutation Damage Score 0.5118 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nephrocystin protein that interacts with calmodulin and the retinitis pigmentosa GTPase regulator protein. The encoded protein has a central coiled-coil region and two calmodulin-binding IQ domains. It is localized to the primary cilia of renal epithelial cells and connecting cilia of photoreceptor cells. The protein is thought to play a role in ciliary function. Defects in this gene result in Senior-Loken syndrome type 5. Alternative splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 G A 12: 88,425,850 (GRCm39) R426H probably damaging Het
Arl2 G A 19: 6,187,555 (GRCm39) R98C probably damaging Het
Atm A G 9: 53,442,948 (GRCm39) I105T probably damaging Het
Cnnm2 G A 19: 46,842,412 (GRCm39) G565E probably damaging Het
Ddx60 G A 8: 62,436,924 (GRCm39) G958D probably benign Het
Fbxo2 T A 4: 148,250,226 (GRCm39) M252K probably benign Het
Filip1 C A 9: 79,726,040 (GRCm39) A860S probably benign Het
Gm11992 C A 11: 9,011,214 (GRCm39) S218R probably damaging Het
Gnb3 A G 6: 124,814,691 (GRCm39) L69P possibly damaging Het
Gpr18 T G 14: 122,149,389 (GRCm39) H212P possibly damaging Het
Katnip C T 7: 125,361,001 (GRCm39) Q104* probably null Het
Kcnh1 A G 1: 192,019,949 (GRCm39) D425G probably benign Het
Kdm5b T A 1: 134,536,799 (GRCm39) probably null Het
Mcm3ap C T 10: 76,325,366 (GRCm39) T989M possibly damaging Het
Mtor T C 4: 148,623,004 (GRCm39) C1999R probably benign Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Myof A T 19: 37,956,794 (GRCm39) D508E probably benign Het
Or52b2 A T 7: 104,986,539 (GRCm39) I128N probably damaging Het
Or56b2j G A 7: 104,353,163 (GRCm39) V130M possibly damaging Het
Or5l13 T A 2: 87,780,335 (GRCm39) M81L probably benign Het
Osbpl7 A G 11: 96,945,425 (GRCm39) H266R probably damaging Het
Pear1 T C 3: 87,666,424 (GRCm39) Y93C probably damaging Het
Pgr A G 9: 8,965,000 (GRCm39) H881R possibly damaging Het
Rfx1 A G 8: 84,822,444 (GRCm39) E914G possibly damaging Het
Samm50 T C 15: 84,095,259 (GRCm39) I415T probably benign Het
Snx7 T C 3: 117,575,985 (GRCm39) D434G possibly damaging Het
Susd4 G A 1: 182,719,602 (GRCm39) V406M probably benign Het
Syt15 G T 14: 33,944,819 (GRCm39) G122V probably damaging Het
Tlr5 A G 1: 182,800,224 (GRCm39) probably benign Het
Ttc6 T C 12: 57,721,556 (GRCm39) probably null Het
Vmn1r211 C A 13: 23,035,949 (GRCm39) M239I probably benign Het
Vps37a G T 8: 40,993,902 (GRCm39) probably null Het
Other mutations in Iqcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Iqcb1 APN 16 36,678,948 (GRCm39) missense probably benign 0.04
IGL00539:Iqcb1 APN 16 36,678,873 (GRCm39) missense probably damaging 1.00
IGL00763:Iqcb1 APN 16 36,676,649 (GRCm39) splice site probably benign
IGL02247:Iqcb1 APN 16 36,660,258 (GRCm39) missense probably benign 0.34
IGL02444:Iqcb1 APN 16 36,652,273 (GRCm39) nonsense probably null
R0360:Iqcb1 UTSW 16 36,692,670 (GRCm39) missense probably damaging 1.00
R1893:Iqcb1 UTSW 16 36,652,245 (GRCm39) missense probably damaging 1.00
R2220:Iqcb1 UTSW 16 36,663,824 (GRCm39) splice site probably null
R2332:Iqcb1 UTSW 16 36,663,801 (GRCm39) missense possibly damaging 0.50
R3833:Iqcb1 UTSW 16 36,652,276 (GRCm39) nonsense probably null
R4841:Iqcb1 UTSW 16 36,655,952 (GRCm39) missense probably benign 0.00
R4842:Iqcb1 UTSW 16 36,655,952 (GRCm39) missense probably benign 0.00
R6574:Iqcb1 UTSW 16 36,691,863 (GRCm39) missense probably damaging 1.00
R6612:Iqcb1 UTSW 16 36,692,023 (GRCm39) unclassified probably benign
R6939:Iqcb1 UTSW 16 36,660,274 (GRCm39) missense possibly damaging 0.80
R7620:Iqcb1 UTSW 16 36,676,772 (GRCm39) missense probably benign
R7716:Iqcb1 UTSW 16 36,687,969 (GRCm39) missense probably benign
R8247:Iqcb1 UTSW 16 36,678,836 (GRCm39) missense probably benign 0.34
R8976:Iqcb1 UTSW 16 36,692,005 (GRCm39) missense probably benign 0.03
R9081:Iqcb1 UTSW 16 36,656,006 (GRCm39) missense probably null 0.98
R9404:Iqcb1 UTSW 16 36,671,632 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAATGCCTATGGAAGTTAGAC -3'
(R):5'- CTTGTATGTTCAGCCAGATATGG -3'

Sequencing Primer
(F):5'- CAATGCCTATGGAAGTTAGACTATTC -3'
(R):5'- GAAGGGATAGATATGGCATACATCC -3'
Posted On 2018-07-24