Mutagenetix > Incidental Mutations

Incidental Mutation 'R6715:Ttc6'

529301

Institutional Source

Beutler Lab

Gene Symbol

Ttc6

Ensembl Gene

ENSMUSG00000046782

Gene Name

tetratricopeptide repeat domain 6

Synonyms

EG639426, LOC217602, Gm9813

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R6715 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57564113-57737928 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 57674770 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172939]

Predicted Effect

probably null
Transcript: ENSMUST00000172939

SMART Domains

Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782

Domain	Start	End	E-Value	Type
coiled coil region	18	42	N/A	INTRINSIC
low complexity region	146	162	N/A	INTRINSIC
low complexity region	188	212	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	486	495	N/A	INTRINSIC
low complexity region	670	685	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC
TPR	889	922	2e-4	SMART
TPR	957	989	2.36e1	SMART
TPR	990	1022	2.63e1	SMART
TPR	1023	1056	9.39e-1	SMART
TPR	1057	1090	3.78e-5	SMART
Blast:TPR	1126	1157	1e-11	BLAST
SEL1	1160	1192	3.39e1	SMART
TPR	1160	1194	4.44e1	SMART
TPR	1195	1228	7.87e0	SMART
Blast:TPR	1229	1262	1e-11	BLAST
TPR	1297	1330	1.24e0	SMART
SEL1	1341	1372	9.26e-1	SMART
TPR	1341	1374	3.45e-8	SMART
TPR	1375	1407	8.76e-1	SMART
TPR	1408	1441	1.45e-1	SMART
TPR	1442	1475	1.36e1	SMART
TPR	1476	1509	7.34e-3	SMART
TPR	1513	1546	1.01e0	SMART
TPR	1547	1580	2.55e-2	SMART
TPR	1581	1617	2.43e1	SMART
Blast:TPR	1618	1651	4e-12	BLAST
TPR	1652	1685	7.87e0	SMART
TPR	1686	1718	2.35e-1	SMART
SEL1	1719	1750	1.21e2	SMART
TPR	1719	1752	1.65e-5	SMART
TPR	1753	1786	1.66e-1	SMART
TPR	1787	1820	1.45e-1	SMART
TPR	1821	1854	3.27e0	SMART

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.9%

Validation Efficiency

100% (35/35)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	G	A	12: 88,459,080	R426H	probably damaging	Het
Arl2	G	A	19: 6,137,525	R98C	probably damaging	Het
Atm	A	G	9: 53,531,648	I105T	probably damaging	Het
Cnnm2	G	A	19: 46,853,973	G565E	probably damaging	Het
D430042O09Rik	C	T	7: 125,761,829	Q104*	probably null	Het
Ddx60	G	A	8: 61,983,890	G958D	probably benign	Het
Fbxo2	T	A	4: 148,165,769	M252K	probably benign	Het
Filip1	C	A	9: 79,818,758	A860S	probably benign	Het
Gm11992	C	A	11: 9,061,214	S218R	probably damaging	Het
Gnb3	A	G	6: 124,837,728	L69P	possibly damaging	Het
Gpr18	T	G	14: 121,911,977	H212P	possibly damaging	Het
Iqcb1	T	C	16: 36,835,629	F126S	probably damaging	Het
Kcnh1	A	G	1: 192,337,641	D425G	probably benign	Het
Kdm5b	T	A	1: 134,609,061		probably null	Het
Mcm3ap	C	T	10: 76,489,532	T989M	possibly damaging	Het
Mtor	T	C	4: 148,538,547	C1999R	probably benign	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Myof	A	T	19: 37,968,346	D508E	probably benign	Het
Olfr1156	T	A	2: 87,949,991	M81L	probably benign	Het
Olfr663	G	A	7: 104,703,956	V130M	possibly damaging	Het
Olfr691	A	T	7: 105,337,332	I128N	probably damaging	Het
Osbpl7	A	G	11: 97,054,599	H266R	probably damaging	Het
Pear1	T	C	3: 87,759,117	Y93C	probably damaging	Het
Pgr	A	G	9: 8,964,999	H881R	possibly damaging	Het
Rfx1	A	G	8: 84,095,815	E914G	possibly damaging	Het
Samm50	T	C	15: 84,211,058	I415T	probably benign	Het
Snx7	T	C	3: 117,782,336	D434G	possibly damaging	Het
Susd4	G	A	1: 182,892,037	V406M	probably benign	Het
Syt15	G	T	14: 34,222,862	G122V	probably damaging	Het
Tlr5	A	G	1: 182,972,659		probably benign	Het
Vmn1r211	C	A	13: 22,851,779	M239I	probably benign	Het
Vps37a	G	T	8: 40,540,861		probably null	Het

Other mutations in Ttc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03278:Ttc6	APN	12	57622026	missense	probably damaging	0.99
IGL02802:Ttc6	UTSW	12	57575868	missense	probably benign	0.14
PIT4802001:Ttc6	UTSW	12	57725676	missense	possibly damaging	0.89
R0698:Ttc6	UTSW	12	57673216	missense	probably benign	0.04
R0988:Ttc6	UTSW	12	57688649	splice site	probably benign
R1290:Ttc6	UTSW	12	57660413	missense	probably benign	0.00
R1338:Ttc6	UTSW	12	57616369	missense	probably benign	0.10
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1481:Ttc6	UTSW	12	57737130	missense	probably damaging	1.00
R1488:Ttc6	UTSW	12	57649515	missense	possibly damaging	0.66
R1558:Ttc6	UTSW	12	57686346	missense	probably benign	0.14
R1570:Ttc6	UTSW	12	57674763	missense	probably damaging	0.98
R1619:Ttc6	UTSW	12	57737668	missense	possibly damaging	0.73
R1819:Ttc6	UTSW	12	57694500	critical splice donor site	probably null
R1826:Ttc6	UTSW	12	57660247	missense	probably benign	0.10
R1863:Ttc6	UTSW	12	57714095	missense	probably benign	0.04
R1872:Ttc6	UTSW	12	57704552	critical splice donor site	probably null
R1887:Ttc6	UTSW	12	57673258	missense	probably benign	0.04
R1937:Ttc6	UTSW	12	57616323	missense	probably benign	0.02
R2014:Ttc6	UTSW	12	57576217	missense	possibly damaging	0.92
R2056:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2058:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2059:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2152:Ttc6	UTSW	12	57705552	missense	probably damaging	0.98
R2179:Ttc6	UTSW	12	57673118	missense	possibly damaging	0.62
R2275:Ttc6	UTSW	12	57702298	missense	probably benign	0.01
R2432:Ttc6	UTSW	12	57622035	missense	possibly damaging	0.79
R2474:Ttc6	UTSW	12	57575927	missense	probably benign	0.37
R2853:Ttc6	UTSW	12	57576181	missense	probably damaging	0.96
R3848:Ttc6	UTSW	12	57677146	missense	probably damaging	0.97
R3853:Ttc6	UTSW	12	57728549	missense	possibly damaging	0.88
R3950:Ttc6	UTSW	12	57649506	missense	probably damaging	0.97
R3953:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3954:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3955:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3957:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R4135:Ttc6	UTSW	12	57632795	intron	probably benign
R4387:Ttc6	UTSW	12	57643050	missense	probably benign	0.00
R4577:Ttc6	UTSW	12	57576655	missense	probably benign	0.22
R4747:Ttc6	UTSW	12	57674692	missense	possibly damaging	0.86
R4779:Ttc6	UTSW	12	57729451	missense	probably damaging	1.00
R4803:Ttc6	UTSW	12	57728505	missense	probably damaging	1.00
R4871:Ttc6	UTSW	12	57702356	missense	probably damaging	0.96
R4898:Ttc6	UTSW	12	57660240	missense	probably benign	0.00
R4930:Ttc6	UTSW	12	57673823	critical splice donor site	probably null
R4946:Ttc6	UTSW	12	57643140	missense	probably benign	0.01
R5257:Ttc6	UTSW	12	57702275	missense	possibly damaging	0.92
R5303:Ttc6	UTSW	12	57575820	missense	possibly damaging	0.90
R5385:Ttc6	UTSW	12	57643035	splice site	probably null
R5402:Ttc6	UTSW	12	57737031	nonsense	probably null
R5428:Ttc6	UTSW	12	57689834	missense	probably null	0.98
R5436:Ttc6	UTSW	12	57674594	splice site	probably null
R5646:Ttc6	UTSW	12	57576019	missense	probably damaging	0.99
R5697:Ttc6	UTSW	12	57677214	missense	probably benign	0.22
R5792:Ttc6	UTSW	12	57673204	missense	possibly damaging	0.71
R5808:Ttc6	UTSW	12	57617611	missense	possibly damaging	0.84
R5842:Ttc6	UTSW	12	57737016	missense	probably damaging	1.00
R5935:Ttc6	UTSW	12	57673804	missense	probably damaging	0.98
R6144:Ttc6	UTSW	12	57673100	missense	possibly damaging	0.83
R6155:Ttc6	UTSW	12	57737616	missense	possibly damaging	0.84
R6283:Ttc6	UTSW	12	57702262	missense	possibly damaging	0.95
R6371:Ttc6	UTSW	12	57728463	missense	possibly damaging	0.89
R6738:Ttc6	UTSW	12	57688640	missense	probably damaging	0.99
R6795:Ttc6	UTSW	12	57704413	missense	probably damaging	0.96
R6959:Ttc6	UTSW	12	57658142	splice site	probably null
R7053:Ttc6	UTSW	12	57660532	missense	probably benign	0.01
R7125:Ttc6	UTSW	12	57576339	missense	probably benign	0.00
R7259:Ttc6	UTSW	12	57576184	missense	probably benign	0.00
R7304:Ttc6	UTSW	12	57576051	missense	probably damaging	0.96
R7369:Ttc6	UTSW	12	57672931	critical splice acceptor site	probably null
R7409:Ttc6	UTSW	12	57696986	missense	probably damaging	0.99
R7429:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7430:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7492:Ttc6	UTSW	12	57673136	missense	probably benign	0.02
R7535:Ttc6	UTSW	12	57576519	missense	probably benign	0.00
R7866:Ttc6	UTSW	12	57674649	missense	probably damaging	0.97
R7901:Ttc6	UTSW	12	57688567	missense	probably damaging	1.00
R7949:Ttc6	UTSW	12	57674649	missense	probably damaging	0.97
R7984:Ttc6	UTSW	12	57688567	missense	probably damaging	1.00
R8062:Ttc6	UTSW	12	57736978	missense	possibly damaging	0.90
X0021:Ttc6	UTSW	12	57576118	missense	probably damaging	0.96
X0058:Ttc6	UTSW	12	57706851	missense	probably damaging	0.99
Z1176:Ttc6	UTSW	12	57697375	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- AGGCATACTTGTCAAAGGCAG -3'
(R):5'- GAATATGTGATGACTCTTAAGGGC -3'

Sequencing Primer
(F):5'- CTTGTCAAAGGCAGAGATTTTCAGAG -3'
(R):5'- ACTCTTAAGGGCTTTACAAGGG -3'

Posted On

2018-07-24