Incidental Mutation 'R6844:Samd8'
List |< first << previous [record 29 of 41] next >> last >|
ID534685
Institutional Source Beutler Lab
Gene Symbol Samd8
Ensembl Gene ENSMUSG00000021770
Gene Namesterile alpha motif domain containing 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location21750531-21798726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21775137 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 54 (S54P)
Ref Sequence ENSEMBL: ENSMUSP00000112803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022292] [ENSMUST00000119430] [ENSMUST00000144061]
Predicted Effect probably damaging
Transcript: ENSMUST00000022292
AA Change: S117P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022292
Gene: ENSMUSG00000021770
AA Change: S117P

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
SAM 72 141 1.86e-3 SMART
transmembrane domain 215 237 N/A INTRINSIC
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 297 319 N/A INTRINSIC
Pfam:PAP2_C 355 428 3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119430
AA Change: S54P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112803
Gene: ENSMUSG00000021770
AA Change: S54P

DomainStartEndE-ValueType
SAM 9 78 1.86e-3 SMART
transmembrane domain 152 174 N/A INTRINSIC
transmembrane domain 199 221 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Pfam:PAP2_C 292 365 6.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144061
SMART Domains Protein: ENSMUSP00000117603
Gene: ENSMUSG00000021770

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Meta Mutation Damage Score 0.4361 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ceramide phosphoethanolamine synthase activity but normal liver, kidney and spleen histology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Samd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Samd8 APN 14 21780100 missense probably damaging 1.00
IGL01837:Samd8 APN 14 21774959 splice site probably benign
IGL02188:Samd8 APN 14 21783798 critical splice donor site probably null
IGL02338:Samd8 APN 14 21775476 missense possibly damaging 0.95
IGL02437:Samd8 APN 14 21775423 missense probably benign 0.11
IGL02643:Samd8 APN 14 21793144 missense probably damaging 1.00
skellington UTSW 14 21783798 critical splice donor site probably null
Stern UTSW 14 21775153 missense possibly damaging 0.79
wellington UTSW 14 21775137 missense probably damaging 1.00
R0993:Samd8 UTSW 14 21775495 missense probably damaging 1.00
R1529:Samd8 UTSW 14 21775159 missense possibly damaging 0.53
R2200:Samd8 UTSW 14 21775320 missense probably benign 0.00
R3801:Samd8 UTSW 14 21775065 missense probably damaging 0.99
R3803:Samd8 UTSW 14 21775065 missense probably damaging 0.99
R3981:Samd8 UTSW 14 21780180 missense probably null 1.00
R4094:Samd8 UTSW 14 21793045 missense probably damaging 1.00
R4232:Samd8 UTSW 14 21780145 missense probably benign
R4847:Samd8 UTSW 14 21792435 missense possibly damaging 0.65
R5402:Samd8 UTSW 14 21775168 missense probably damaging 1.00
R5421:Samd8 UTSW 14 21792495 missense probably damaging 1.00
R5955:Samd8 UTSW 14 21793084 missense probably damaging 1.00
R6180:Samd8 UTSW 14 21775025 missense probably benign 0.04
R6447:Samd8 UTSW 14 21792556 critical splice donor site probably null
R6451:Samd8 UTSW 14 21783798 critical splice donor site probably null
R6914:Samd8 UTSW 14 21775153 missense possibly damaging 0.79
R6942:Samd8 UTSW 14 21775153 missense possibly damaging 0.79
R7101:Samd8 UTSW 14 21775374 missense probably benign 0.00
R7485:Samd8 UTSW 14 21792423 missense probably benign 0.00
R8256:Samd8 UTSW 14 21783677 critical splice acceptor site probably null
R8280:Samd8 UTSW 14 21780151 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTCCCTTGACAGGAAGTAGAG -3'
(R):5'- AACTCAAGTCAGGGATGGGC -3'

Sequencing Primer
(F):5'- GAAAGAAATGGCAGGTCCTAGTC -3'
(R):5'- TGGGCTCTCCGTTACAGAG -3'
Posted On2018-09-12