Incidental Mutation 'R1529:Samd8'
ID166488
Institutional Source Beutler Lab
Gene Symbol Samd8
Ensembl Gene ENSMUSG00000021770
Gene Namesterile alpha motif domain containing 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R1529 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location21750531-21798726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21775159 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 124 (V124D)
Ref Sequence ENSEMBL: ENSMUSP00000022292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022292] [ENSMUST00000119430] [ENSMUST00000144061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022292
AA Change: V124D

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022292
Gene: ENSMUSG00000021770
AA Change: V124D

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
SAM 72 141 1.86e-3 SMART
transmembrane domain 215 237 N/A INTRINSIC
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 297 319 N/A INTRINSIC
Pfam:PAP2_C 355 428 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119430
AA Change: V61D

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112803
Gene: ENSMUSG00000021770
AA Change: V61D

DomainStartEndE-ValueType
SAM 9 78 1.86e-3 SMART
transmembrane domain 152 174 N/A INTRINSIC
transmembrane domain 199 221 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Pfam:PAP2_C 292 365 6.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144061
SMART Domains Protein: ENSMUSP00000117603
Gene: ENSMUSG00000021770

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ceramide phosphoethanolamine synthase activity but normal liver, kidney and spleen histology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
Adam11 T C 11: 102,775,113 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Ap1b1 T G 11: 5,039,547 F793C probably damaging Het
Arfgef3 G A 10: 18,613,222 R1292* probably null Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp2b4 A G 1: 133,717,988 F943L probably damaging Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Fgd3 T C 13: 49,266,694 N569S probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc12a1 C T 2: 125,190,295 T622I probably damaging Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tbc1d24 A G 17: 24,185,979 C64R probably damaging Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tiam2 T C 17: 3,516,703 V1506A probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Samd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Samd8 APN 14 21780100 missense probably damaging 1.00
IGL01837:Samd8 APN 14 21774959 splice site probably benign
IGL02188:Samd8 APN 14 21783798 critical splice donor site probably null
IGL02338:Samd8 APN 14 21775476 missense possibly damaging 0.95
IGL02437:Samd8 APN 14 21775423 missense probably benign 0.11
IGL02643:Samd8 APN 14 21793144 missense probably damaging 1.00
skellington UTSW 14 21783798 critical splice donor site probably null
Stern UTSW 14 21775153 missense possibly damaging 0.79
wellington UTSW 14 21775137 missense probably damaging 1.00
R0993:Samd8 UTSW 14 21775495 missense probably damaging 1.00
R2200:Samd8 UTSW 14 21775320 missense probably benign 0.00
R3801:Samd8 UTSW 14 21775065 missense probably damaging 0.99
R3803:Samd8 UTSW 14 21775065 missense probably damaging 0.99
R3981:Samd8 UTSW 14 21780180 missense probably null 1.00
R4094:Samd8 UTSW 14 21793045 missense probably damaging 1.00
R4232:Samd8 UTSW 14 21780145 missense probably benign
R4847:Samd8 UTSW 14 21792435 missense possibly damaging 0.65
R5402:Samd8 UTSW 14 21775168 missense probably damaging 1.00
R5421:Samd8 UTSW 14 21792495 missense probably damaging 1.00
R5955:Samd8 UTSW 14 21793084 missense probably damaging 1.00
R6180:Samd8 UTSW 14 21775025 missense probably benign 0.04
R6447:Samd8 UTSW 14 21792556 critical splice donor site probably null
R6451:Samd8 UTSW 14 21783798 critical splice donor site probably null
R6844:Samd8 UTSW 14 21775137 missense probably damaging 1.00
R6914:Samd8 UTSW 14 21775153 missense possibly damaging 0.79
R6942:Samd8 UTSW 14 21775153 missense possibly damaging 0.79
R7101:Samd8 UTSW 14 21775374 missense probably benign 0.00
R7485:Samd8 UTSW 14 21792423 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTCAACTCTGCATTCGCCGC -3'
(R):5'- TGTCAGGCACACGCTCATGAAC -3'

Sequencing Primer
(F):5'- ATTCGCCGCTGGACTAC -3'
(R):5'- TCCAGTCTTCGAGCAGAATG -3'
Posted On2014-04-13