Incidental Mutation 'R6865:Msrb1'
ID535886
Institutional Source Beutler Lab
Gene Symbol Msrb1
Ensembl Gene ENSMUSG00000075705
Gene Namemethionine sulfoxide reductase B1
SynonymsSepr, SelR, Sepx1, D17Wsu82e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6865 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24736642-24742778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24736711 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000110917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045186] [ENSMUST00000101800] [ENSMUST00000115262] [ENSMUST00000170239] [ENSMUST00000183214]
Predicted Effect probably benign
Transcript: ENSMUST00000045186
SMART Domains Protein: ENSMUSP00000038326
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 181 5.1e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101800
AA Change: S2P

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099300
Gene: ENSMUSG00000075705
AA Change: S2P

DomainStartEndE-ValueType
Pfam:SelR 5 105 9.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115262
AA Change: S2P

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110917
Gene: ENSMUSG00000075705
AA Change: S2P

DomainStartEndE-ValueType
Pfam:SelR 7 106 6.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170239
SMART Domains Protein: ENSMUSP00000129325
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 375 1.2e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183214
SMART Domains Protein: ENSMUSP00000138489
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 133 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the methionine-R-sulfoxide reductase B (MsrB) family. Members of this family function as repair enzymes that protect proteins from oxidative stress by catalyzing the reduction of methionine-R-sulfoxides to methionines. This protein is highly expressed in liver and kidney, and is localized to the nucleus and cytosol. It is the only member of the MsrB family that is a selenoprotein, containing a selenocysteine (Sec) residue at its active site. It also has the highest methionine-R-sulfoxide reductase activity compared to other members containing cysteine in place of Sec. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T A 13: 4,270,213 M293L possibly damaging Het
Ankrd11 T C 8: 122,894,944 D723G probably benign Het
Ankrd26 T C 6: 118,523,481 R1010G possibly damaging Het
Apob G A 12: 8,008,847 R2410H probably benign Het
Auh T C 13: 52,838,129 D275G probably damaging Het
Card10 G T 15: 78,802,622 D47E possibly damaging Het
Ccdc141 C T 2: 77,029,235 probably null Het
Cfap206 T C 4: 34,714,448 Y416C possibly damaging Het
Chuk A T 19: 44,086,915 Y500* probably null Het
Cop1 T A 1: 159,308,954 D536E probably damaging Het
Crh G C 3: 19,694,140 P113A possibly damaging Het
Ddx54 T G 5: 120,621,827 probably null Het
Efcab7 T C 4: 99,912,596 S127P probably damaging Het
Efhc1 A G 1: 20,960,218 Y125C probably damaging Het
Fga T A 3: 83,031,541 C408S probably damaging Het
Flot2 T C 11: 78,049,492 S22P probably benign Het
Fndc1 T A 17: 7,772,840 T675S unknown Het
Foxc1 A G 13: 31,808,853 D549G unknown Het
Gldc T C 19: 30,133,762 N538S possibly damaging Het
Grk4 T G 5: 34,731,550 V346G probably damaging Het
Gucy2c T C 6: 136,770,129 R111G probably benign Het
Heatr6 C T 11: 83,769,140 H504Y probably damaging Het
Lrp5 A T 19: 3,620,013 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo3a A G 2: 22,574,301 I185V probably benign Het
Myo5c T C 9: 75,269,596 S608P probably benign Het
Nek6 A G 2: 38,569,666 I174V probably benign Het
Nmt2 T C 2: 3,314,729 V252A probably damaging Het
Nudt9 G T 5: 104,059,679 R179M probably damaging Het
Nwd1 T C 8: 72,657,062 V29A possibly damaging Het
Olah T C 2: 3,342,927 D216G possibly damaging Het
Olfr156 T C 4: 43,821,346 N5S probably benign Het
Olfr666 T C 7: 104,893,512 I39V probably benign Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Pkd1 T C 17: 24,576,487 V2318A probably benign Het
Pknox1 T A 17: 31,588,560 M51K probably damaging Het
Ppp1r12a C T 10: 108,262,381 R321* probably null Het
Pxdn A G 12: 30,014,583 probably null Het
Rab44 A T 17: 29,139,227 I130F probably benign Het
Rnf130 T C 11: 50,071,264 I179T probably damaging Het
Slc22a28 A T 19: 8,064,491 C450* probably null Het
Slco1c1 A T 6: 141,540,052 Y136F probably damaging Het
Synj2 C T 17: 6,017,569 Q106* probably null Het
Uckl1 T C 2: 181,574,493 N138S probably damaging Het
Usp19 G T 9: 108,498,819 E203* probably null Het
Vdr A G 15: 97,857,505 I379T probably damaging Het
Zfp503 C A 14: 21,986,033 G272C probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Zzz3 T A 3: 152,428,053 D249E probably benign Het
Other mutations in Msrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3922:Msrb1 UTSW 17 24740083 missense probably damaging 0.97
R4776:Msrb1 UTSW 17 24740173 missense probably damaging 1.00
R5466:Msrb1 UTSW 17 24739559 missense possibly damaging 0.82
R7196:Msrb1 UTSW 17 24739582 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCTCTGGGTAAACTTGGCTG -3'
(R):5'- AGTCCTCCTGCTCCAGAATG -3'

Sequencing Primer
(F):5'- AGAGACTCCTTGAGGGCG -3'
(R):5'- CTGCTCCAGAATGCCCTG -3'
Posted On2018-10-18