Incidental Mutation 'R6934:Vmn2r-ps117'
ID540223
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps117
Ensembl Gene ENSMUSG00000093531
Gene Namevomeronasal 2, receptor, pseudogene 117
SynonymsEG665303
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6934 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18810835-18838900 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 18824705 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 461 (Y461*)
Ref Sequence ENSEMBL: ENSMUSP00000156026 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000176899
AA Change: Y461*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T A 8: 121,539,973 Y58F probably benign Het
9530003J23Rik C T 10: 117,238,508 D25N probably benign Het
Asap2 T C 12: 21,168,250 V58A probably damaging Het
BC067074 T C 13: 113,369,266 S2310P probably benign Het
Bccip A G 7: 133,720,791 M289V probably benign Het
Bhmt2 A T 13: 93,662,311 I334N probably benign Het
Copa T A 1: 172,110,686 I513N possibly damaging Het
Ctif G A 18: 75,435,360 T569M probably benign Het
Dennd1a A T 2: 37,801,213 M231K possibly damaging Het
Dnah3 A G 7: 120,054,601 probably null Het
Fat3 T C 9: 16,376,956 I424V probably damaging Het
Foxred2 G T 15: 77,952,330 C328* probably null Het
Gemin5 A T 11: 58,147,912 H590Q probably damaging Het
Gm5475 T C 15: 100,427,126 probably benign Het
Gmip A G 8: 69,820,926 T956A probably benign Het
Hmbox1 A T 14: 64,896,832 D106E probably benign Het
Irs2 A T 8: 11,004,697 I1245N probably damaging Het
Kcnk1 A G 8: 126,025,390 Y245C probably damaging Het
Krtap4-9 A T 11: 99,785,882 R210* probably null Het
Lama1 A G 17: 67,774,543 D1325G probably benign Het
Mep1a A T 17: 43,482,230 V361E probably damaging Het
Mrgprx2 A G 7: 48,482,065 I92T possibly damaging Het
Nup214 A T 2: 31,982,671 R242* probably null Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr484 A G 7: 108,124,819 V148A probably benign Het
Olfr538 T G 7: 140,574,651 L166R probably damaging Het
Olfr905 T G 9: 38,473,176 I143S probably benign Het
Orc2 T C 1: 58,500,364 K39E probably benign Het
Ppl C T 16: 5,094,509 G736D probably benign Het
Ppp2r1a A G 17: 20,961,633 E471G possibly damaging Het
Prrc2c G A 1: 162,720,505 P161S probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Saal1 A G 7: 46,702,664 C144R probably benign Het
Slc29a4 G A 5: 142,712,958 V125I probably benign Het
Smarcc2 A G 10: 128,469,672 T322A probably benign Het
Srgap2 A T 1: 131,317,231 M591K possibly damaging Het
Stard9 A G 2: 120,697,695 I1478V probably benign Het
Tet2 A G 3: 133,483,237 probably null Het
Tmem150c C T 5: 100,095,606 probably null Het
Tmem39b T A 4: 129,678,573 H412L possibly damaging Het
Tox A C 4: 6,697,635 H389Q probably damaging Het
Trank1 T C 9: 111,373,090 I1595T probably damaging Het
Vps13a T C 19: 16,676,194 H1941R probably damaging Het
Other mutations in Vmn2r-ps117
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6903:Vmn2r-ps117 UTSW 17 18838290 missense possibly damaging 0.94
R6912:Vmn2r-ps117 UTSW 17 18827202 missense probably damaging 1.00
R6953:Vmn2r-ps117 UTSW 17 18824833 missense probably benign
R6974:Vmn2r-ps117 UTSW 17 18838233 missense probably benign 0.15
R7373:Vmn2r-ps117 UTSW 17 18824686 missense probably benign
R7630:Vmn2r-ps117 UTSW 17 18824647 missense probably benign 0.01
R7776:Vmn2r-ps117 UTSW 17 18823672 missense probably damaging 0.96
R8060:Vmn2r-ps117 UTSW 17 18837862 missense possibly damaging 0.85
R8126:Vmn2r-ps117 UTSW 17 18822552 missense probably benign 0.00
Z1177:Vmn2r-ps117 UTSW 17 18838076 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTACAGTCAGGTTTTCACTAAGTCATC -3'
(R):5'- CTCCAAGTGTAATGGAACTTGAG -3'

Sequencing Primer
(F):5'- TGTTGATGTTCACAACAGA -3'
(R):5'- GCTGGCCATTGTATCATCT -3'
Posted On2018-11-06