Incidental Mutation 'R6955:Mcam'
ID541417
Institutional Source Beutler Lab
Gene Symbol Mcam
Ensembl Gene ENSMUSG00000032135
Gene Namemelanoma cell adhesion molecule
SynonymsMuc18, CD146, s-gicerin, 1-gicerin, s-endo
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R6955 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44134469-44142727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44139269 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 286 (I286N)
Ref Sequence ENSEMBL: ENSMUSP00000096451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034650] [ENSMUST00000098852] [ENSMUST00000147836] [ENSMUST00000149241] [ENSMUST00000206147] [ENSMUST00000206720] [ENSMUST00000216002]
Predicted Effect probably damaging
Transcript: ENSMUST00000034650
AA Change: I286N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034650
Gene: ENSMUSG00000032135
AA Change: I286N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098852
AA Change: I286N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096451
Gene: ENSMUSG00000032135
AA Change: I286N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147836
SMART Domains Protein: ENSMUSP00000117924
Gene: ENSMUSG00000032135

DomainStartEndE-ValueType
Pfam:V-set 2 97 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149241
SMART Domains Protein: ENSMUSP00000121090
Gene: ENSMUSG00000032135

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206147
Predicted Effect probably benign
Transcript: ENSMUST00000206720
Predicted Effect probably benign
Transcript: ENSMUST00000216002
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in endothelial cells exhibit impaired VEGF-induced angiogenesis in Matrigel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,294,307 F2057I probably benign Het
Abl2 A G 1: 156,622,649 T108A probably damaging Het
Amfr A T 8: 94,000,376 W70R probably damaging Het
Cacna1h T C 17: 25,388,056 T963A probably damaging Het
Cdca2 A G 14: 67,715,004 M1T probably null Het
Chd2 A G 7: 73,475,423 V62A probably damaging Het
Cpeb4 T A 11: 31,908,864 L87Q possibly damaging Het
Ddx17 T C 15: 79,530,467 M500V probably benign Het
Emilin1 T C 5: 30,917,909 L498P probably damaging Het
Fhod1 C T 8: 105,333,007 C682Y probably benign Het
Fshr A T 17: 88,985,466 S595T probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Inf2 T C 12: 112,610,731 V1003A unknown Het
Itpr3 A G 17: 27,121,467 E2651G probably damaging Het
Kalrn A G 16: 34,220,136 W735R probably damaging Het
Kdelc1 A T 1: 44,117,097 L110Q probably damaging Het
Kif5b T C 18: 6,211,070 N798S probably benign Het
Klb T A 5: 65,379,088 L587* probably null Het
Krt82 T A 15: 101,542,849 D375V probably damaging Het
Lig4 A T 8: 9,973,384 V132D probably damaging Het
Lrpprc T C 17: 84,776,989 I99V probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myh15 G T 16: 49,081,235 probably null Het
Nup210 T C 6: 91,087,927 E197G probably damaging Het
Nup93 T A 8: 94,309,673 Y702N probably damaging Het
Olfr1192-ps1 T A 2: 88,653,004 I284N probably damaging Het
Osbpl8 T C 10: 111,269,444 probably null Het
Pdzd2 A G 15: 12,401,464 S767P probably damaging Het
Plcd1 A T 9: 119,071,856 N765K probably benign Het
Rnf208 T C 2: 25,243,402 V36A probably benign Het
Rpl5 G A 5: 107,902,046 R33Q probably benign Het
Selp A T 1: 164,144,909 I706F possibly damaging Het
Sfmbt1 A G 14: 30,766,034 probably benign Het
Slc25a39 T C 11: 102,403,518 I328V probably benign Het
Smc4 G A 3: 69,024,309 E604K possibly damaging Het
Sorcs3 A G 19: 48,749,343 Y733C possibly damaging Het
Ttll5 T C 12: 85,864,579 V237A possibly damaging Het
Uimc1 T A 13: 55,040,546 R567W possibly damaging Het
Wbp4 A T 14: 79,472,360 I145N probably benign Het
Xbp1 A G 11: 5,522,018 E32G probably null Het
Other mutations in Mcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Mcam APN 9 44140250 missense probably benign 0.01
IGL02671:Mcam APN 9 44137034 splice site probably benign
IGL02682:Mcam APN 9 44140417 missense possibly damaging 0.80
IGL03384:Mcam APN 9 44140512 unclassified probably benign
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0320:Mcam UTSW 9 44140186 missense possibly damaging 0.89
R1432:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1485:Mcam UTSW 9 44136763 missense probably damaging 1.00
R1503:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1730:Mcam UTSW 9 44134706 missense probably damaging 1.00
R1783:Mcam UTSW 9 44134706 missense probably damaging 1.00
R2146:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2150:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2215:Mcam UTSW 9 44139953 nonsense probably null
R4366:Mcam UTSW 9 44134697 missense probably damaging 1.00
R4519:Mcam UTSW 9 44141343 missense possibly damaging 0.95
R4948:Mcam UTSW 9 44136566 missense probably damaging 1.00
R5965:Mcam UTSW 9 44136628 missense probably damaging 1.00
R6704:Mcam UTSW 9 44136920 missense probably benign 0.06
R7273:Mcam UTSW 9 44140944 missense possibly damaging 0.78
R7529:Mcam UTSW 9 44138895 missense probably benign 0.08
R7623:Mcam UTSW 9 44139658 missense probably benign 0.28
R7659:Mcam UTSW 9 44136770 missense unknown
R8066:Mcam UTSW 9 44140960 missense probably damaging 1.00
Z1177:Mcam UTSW 9 44134590 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTGTCAAATTCGGGGCC -3'
(R):5'- GACTCTGACACTGGTAGAGC -3'

Sequencing Primer
(F):5'- AAATTCGGGGCCACCTCTTG -3'
(R):5'- AGGACAGGAGCCCATTTTCATCG -3'
Posted On2018-11-28