Incidental Mutation 'R6958:Nhp2'
ID541591
Institutional Source Beutler Lab
Gene Symbol Nhp2
Ensembl Gene ENSMUSG00000001056
Gene NameNHP2 ribonucleoprotein
SynonymsH/ACA small nucleolar RNPs, NHP2, D11Ertd175e, 2410130M07Rik, Nola2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location51619735-51623714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51623107 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 118 (T118A)
Ref Sequence ENSEMBL: ENSMUSP00000120014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001081] [ENSMUST00000127405] [ENSMUST00000136020]
Predicted Effect probably benign
Transcript: ENSMUST00000001081
SMART Domains Protein: ENSMUSP00000001081
Gene: ENSMUSG00000001054

DomainStartEndE-ValueType
LisH 116 148 3.6e-4 SMART
CTLH 155 212 7.82e-14 SMART
CRA 210 304 1.63e-21 SMART
Pfam:zf-RING_UBOX 338 377 3.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127405
AA Change: T118A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120014
Gene: ENSMUSG00000001056
AA Change: T118A

DomainStartEndE-ValueType
Pfam:Ribosomal_L7Ae 45 139 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136020
SMART Domains Protein: ENSMUSP00000120636
Gene: ENSMUSG00000001054

DomainStartEndE-ValueType
LisH 116 148 3.6e-4 SMART
CTLH 155 212 7.82e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147009
SMART Domains Protein: ENSMUSP00000118594
Gene: ENSMUSG00000001054

DomainStartEndE-ValueType
Pfam:CLTH 1 91 1.4e-11 PFAM
Pfam:zf-RING_UBOX 130 169 3.1e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Nhp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0324:Nhp2 UTSW 11 51622507 missense possibly damaging 0.74
R0723:Nhp2 UTSW 11 51619923 nonsense probably null
R6038:Nhp2 UTSW 11 51620085 missense probably benign 0.00
R6038:Nhp2 UTSW 11 51620085 missense probably benign 0.00
R6407:Nhp2 UTSW 11 51619903 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCATGTGGGAATATTCAG -3'
(R):5'- CTGGGAAGACTCACACAGCAAG -3'

Sequencing Primer
(F):5'- AATATTCAGTATTGGCTTGGAGGACC -3'
(R):5'- CTCACACAGCAAGAAATCGGGG -3'
Posted On2018-11-28