Incidental Mutation 'R6980:Dnajb3'
ID543728
Institutional Source Beutler Lab
Gene Symbol Dnajb3
Ensembl Gene ENSMUSG00000081984
Gene NameDnaJ heat shock protein family (Hsp40) member B3
SynonymsMSJ-1, Hsj3, Msj1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6980 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location88204732-88205782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88205014 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 222 (D222A)
Ref Sequence ENSEMBL: ENSMUSP00000112703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000119972] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000014263
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049289
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097659
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113134
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119972
AA Change: D222A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112703
Gene: ENSMUSG00000081984
AA Change: D222A

DomainStartEndE-ValueType
DnaJ 2 61 6.22e-33 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C A 2: 25,440,866 R1189S possibly damaging Het
Abcf2 T C 5: 24,565,972 Q594R probably benign Het
Abhd18 G A 3: 40,933,780 S353N probably benign Het
Adrb1 G T 19: 56,723,614 A415S probably benign Het
Art2b T C 7: 101,580,473 N73S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
Cacna1a A G 8: 84,612,285 M1753V possibly damaging Het
Cbx8 A T 11: 119,039,461 I102N possibly damaging Het
Ccdc178 T A 18: 22,105,563 E332D probably benign Het
Cfap74 G A 4: 155,466,352 probably benign Het
Chat A T 14: 32,424,154 M354K probably benign Het
Cmas A G 6: 142,756,800 T10A probably damaging Het
Cyb561d1 A T 3: 108,200,159 L51H probably benign Het
D030056L22Rik A T 19: 18,717,265 N128I probably damaging Het
D130043K22Rik G T 13: 24,864,781 A423S probably damaging Het
Dnah14 T C 1: 181,648,230 I1349T probably benign Het
Dtx1 T C 5: 120,681,357 E592G probably damaging Het
Dzank1 C T 2: 144,490,136 G427R possibly damaging Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Eif4e1b T A 13: 54,784,103 probably null Het
Ell2 A G 13: 75,756,376 M159V probably null Het
Eml4 G A 17: 83,451,017 V377I probably benign Het
Fryl A T 5: 73,050,430 S2466T probably benign Het
Gfpt1 C A 6: 87,077,089 T426K probably damaging Het
Gm28710 T A 5: 16,826,946 V533D possibly damaging Het
Gm49355 T C 14: 12,307,173 probably benign Het
Gm5114 T C 7: 39,409,200 I332V probably benign Het
Gpr15 T A 16: 58,718,742 probably benign Het
Gpr179 T C 11: 97,334,858 E2157G probably benign Het
Gramd4 A G 15: 86,131,969 N482S probably benign Het
Hfm1 A T 5: 106,880,477 I829K probably benign Het
Hydin A T 8: 110,413,284 E728D possibly damaging Het
Ifngr2 T A 16: 91,560,007 V143E probably damaging Het
Ift172 T C 5: 31,257,386 D1390G probably benign Het
Kdf1 A T 4: 133,528,827 D285V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mdn1 G A 4: 32,726,942 probably null Het
Megf11 A G 9: 64,705,850 E1016G probably damaging Het
Mixl1 G A 1: 180,696,888 A42V possibly damaging Het
Mpp2 A G 11: 102,059,328 W567R probably damaging Het
Mrgpra6 A G 7: 47,188,949 L136P probably damaging Het
Mroh7 T A 4: 106,700,237 I759L probably benign Het
Nrxn2 A G 19: 6,450,579 D277G probably benign Het
Nup210l A T 3: 90,119,927 K205N probably benign Het
Olfr1040 A T 2: 86,146,337 Y132* probably null Het
Olfr1284 A G 2: 111,379,275 I92V possibly damaging Het
Olfr475-ps1 A G 2: 88,623,595 *97W probably null Het
Olfr603 T C 7: 103,383,096 E302G probably benign Het
Oxnad1 C T 14: 32,085,619 probably benign Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcdhgb5 C T 18: 37,733,539 H796Y possibly damaging Het
Pdlim7 G T 13: 55,508,228 D126E probably benign Het
Pfdn2 C T 1: 171,357,897 probably benign Het
Piezo2 T A 18: 63,082,961 probably null Het
Pms2 A T 5: 143,912,024 I43L probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ptpn4 T A 1: 119,743,421 E202D possibly damaging Het
Rnf40 T A 7: 127,594,677 V455E probably damaging Het
Rp1l1 A G 14: 64,028,720 N585S probably benign Het
Rrp12 A G 19: 41,890,143 S188P probably damaging Het
Rsbn1l T A 5: 20,896,484 H686L probably benign Het
Runx2 C T 17: 44,735,316 V107I possibly damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Ryr1 T A 7: 29,109,387 D420V probably benign Het
Sash1 T C 10: 8,729,848 Q926R probably benign Het
Scgb3a2 T A 18: 43,764,434 I6N probably damaging Het
Sdc3 T A 4: 130,816,922 probably benign Het
Sik2 A G 9: 50,897,455 V658A probably benign Het
Slc25a39 A G 11: 102,405,775 V81A probably damaging Het
Snai2 T A 16: 14,708,249 S255T possibly damaging Het
Sorbs1 A T 19: 40,327,616 Y371* probably null Het
Spata31d1b A T 13: 59,715,422 H128L probably benign Het
Spdl1 A T 11: 34,830,879 M1K probably null Het
Tgm3 T A 2: 130,026,777 N211K probably benign Het
Tmem116 T C 5: 121,467,987 probably null Het
Tmem132e T A 11: 82,438,386 probably null Het
Tmem53 T C 4: 117,268,508 C251R probably damaging Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Trp63 T A 16: 25,802,093 F12I probably benign Het
Ttn C T 2: 76,879,057 probably null Het
Tubgcp4 T C 2: 121,195,465 V596A probably benign Het
Ugt2a3 A C 5: 87,325,632 H475Q probably damaging Het
Unc79 G A 12: 103,059,500 R382K probably damaging Het
Vmn2r58 T C 7: 41,864,238 H327R possibly damaging Het
Vmn2r7 G A 3: 64,716,566 T111I possibly damaging Het
Zfp318 T A 17: 46,397,212 Y399N probably damaging Het
Other mutations in Dnajb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Dnajb3 APN 1 88205382 missense probably benign 0.00
IGL02489:Dnajb3 APN 1 88205310 missense probably benign 0.37
IGL02726:Dnajb3 APN 1 88205650 missense probably damaging 1.00
IGL02733:Dnajb3 APN 1 88204940 intron probably benign
IGL02867:Dnajb3 APN 1 88205527 missense probably benign 0.43
R1235:Dnajb3 UTSW 1 88205479 missense probably benign 0.03
R3154:Dnajb3 UTSW 1 88205051 missense probably benign 0.22
R4232:Dnajb3 UTSW 1 88205252 missense possibly damaging 0.75
R4718:Dnajb3 UTSW 1 88205339 missense probably benign 0.13
R5033:Dnajb3 UTSW 1 88205023 missense possibly damaging 0.94
R6393:Dnajb3 UTSW 1 88205662 missense possibly damaging 0.64
R7789:Dnajb3 UTSW 1 88205677 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCTATCCCTGCGATCC -3'
(R):5'- TCGCTTCGTTAGATACTGGATTC -3'

Sequencing Primer
(F):5'- AGGCACCGACATGAGCTG -3'
(R):5'- GCTTCGTTAGATACTGGATTCACATC -3'
Posted On2019-05-13