Incidental Mutation 'R7096:Brms1'
ID550525
Institutional Source Beutler Lab
Gene Symbol Brms1
Ensembl Gene ENSMUSG00000080268
Gene Namebreast cancer metastasis-suppressor 1
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_134155.1; MGI: 2388804

Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R7096 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5041404-5049917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5046680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 130 (I130N)
Ref Sequence ENSEMBL: ENSMUSP00000112266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025818] [ENSMUST00000116567] [ENSMUST00000224178] [ENSMUST00000224288] [ENSMUST00000224363] [ENSMUST00000225427] [ENSMUST00000225799]
Predicted Effect probably benign
Transcript: ENSMUST00000025818
SMART Domains Protein: ENSMUSP00000025818
Gene: ENSMUSG00000024883

DomainStartEndE-ValueType
SH2 66 153 2.16e-5 SMART
low complexity region 241 264 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
low complexity region 307 341 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 432 454 N/A INTRINSIC
VPS9 478 596 2.29e-64 SMART
RA 613 694 1.14e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116567
AA Change: I130N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112266
Gene: ENSMUSG00000080268
AA Change: I130N

DomainStartEndE-ValueType
low complexity region 29 59 N/A INTRINSIC
Pfam:Sds3 60 209 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224178
Predicted Effect probably benign
Transcript: ENSMUST00000224288
Predicted Effect probably benign
Transcript: ENSMUST00000224363
Predicted Effect probably benign
Transcript: ENSMUST00000225427
Predicted Effect probably benign
Transcript: ENSMUST00000225799
Meta Mutation Damage Score 0.6288 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene reduces the metastatic potential, but not the tumorogenicity, of human breast cancer and melanoma cell lines. The protein encoded by this gene localizes primarily to the nucleus and is a component of the mSin3a family of histone deacetylase complexes (HDAC). The protein contains two coiled-coil motifs and several imperfect leucine zipper motifs. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(12) : Targeted(2) Gene trapped(10)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T G 3: 40,933,870 M383R probably damaging Het
Acd T A 8: 105,698,489 E366V possibly damaging Het
Acvr2b T A 9: 119,428,189 probably null Het
Alg10b C T 15: 90,227,361 T136I probably benign Het
Ankrd42 T A 7: 92,591,832 K440* probably null Het
Apc T A 18: 34,315,957 S1969T probably damaging Het
Arhgef25 T C 10: 127,184,028 Y447C probably damaging Het
AW146154 G A 7: 41,481,443 A83V probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Barhl1 T G 2: 28,909,714 I300L probably benign Het
Brd1 C A 15: 88,713,935 R536L probably damaging Het
Ccdc68 A G 18: 69,940,170 H63R probably damaging Het
Ccl28 A G 13: 119,650,893 I74V probably benign Het
Cd300ld T A 11: 114,987,495 I64F possibly damaging Het
Cdkl2 G A 5: 92,033,184 Q199* probably null Het
Cdkn2c C T 4: 109,661,358 R133Q probably benign Het
Coq2 A G 5: 100,663,720 probably benign Het
Coq6 T C 12: 84,361,821 probably null Het
Csmd2 C T 4: 128,462,726 S1608L Het
Cyp11b2 T A 15: 74,855,988 R82W probably damaging Het
Cyp2d10 T C 15: 82,405,261 T217A probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dnah7a T C 1: 53,483,440 I2880V possibly damaging Het
Dync1h1 C A 12: 110,657,078 T3595K probably damaging Het
Ecscr T A 18: 35,715,425 E183V probably damaging Het
Elovl6 A G 3: 129,605,106 N52S probably benign Het
Eps8l1 G T 7: 4,474,191 A455S probably benign Het
Gpat2 A G 2: 127,428,289 N74S probably benign Het
Gstk1 C A 6: 42,249,473 T172K probably damaging Het
Gtf3c1 T C 7: 125,696,559 probably null Het
Gucy2c T C 6: 136,728,341 D532G probably benign Het
Hoxc12 T A 15: 102,937,038 N62K possibly damaging Het
Hsdl1 C A 8: 119,566,325 A124S possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Lcat C T 8: 105,939,677 M404I possibly damaging Het
Ldhb A G 6: 142,501,373 F72L probably benign Het
Map10 T C 8: 125,671,923 L685P probably damaging Het
Me2 A G 18: 73,794,890 V174A probably benign Het
Med13l C A 5: 118,721,926 Q328K possibly damaging Het
Mta2 A T 19: 8,947,775 I336F probably damaging Het
Mterf1a A T 5: 3,891,769 I33N probably damaging Het
Myo15b T A 11: 115,891,498 probably null Het
Myof C A 19: 37,936,200 G1215V probably damaging Het
Nlgn2 G A 11: 69,825,690 T675M probably damaging Het
Olfr385 T A 11: 73,589,637 M34L probably benign Het
Olfr485 C A 7: 108,159,641 M77I probably benign Het
Olfr768 T C 10: 129,093,846 I43V probably damaging Het
Padi3 T C 4: 140,800,124 D122G probably damaging Het
Pcnx3 G A 19: 5,672,615 R1350C probably damaging Het
Pdzrn4 C A 15: 92,397,503 Q197K probably benign Het
Pitpnm2 C T 5: 124,129,261 G639S possibly damaging Het
Piwil4 T A 9: 14,736,816 K156* probably null Het
Pkmyt1 T A 17: 23,734,113 H214Q probably damaging Het
Pnpt1 G A 11: 29,154,867 R597Q probably benign Het
Poteg C A 8: 27,473,567 A344E probably benign Het
Rad21l A G 2: 151,667,920 M87T probably benign Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Rap1gap2 C A 11: 74,392,231 R681L probably damaging Het
Rimbp2 C A 5: 128,774,269 R871L probably damaging Het
Rnf135 T C 11: 80,189,225 V114A probably benign Het
Skiv2l T A 17: 34,841,470 H849L probably benign Het
Snai2 A G 16: 14,707,164 H178R possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Taar1 A T 10: 23,920,911 E169V possibly damaging Het
Tdrd12 G T 7: 35,487,589 D625E Het
Tlr6 A G 5: 64,953,776 V596A probably benign Het
Trak2 T G 1: 58,903,590 N886H probably damaging Het
Tsga10 T A 1: 37,840,614 D32V probably damaging Het
Vmn1r214 A G 13: 23,035,026 D230G probably damaging Het
Vmn2r108 A G 17: 20,462,500 L814S probably damaging Het
Zbbx T C 3: 75,081,737 D353G probably benign Het
Other mutations in Brms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Brms1 APN 19 5049042 unclassified probably benign
IGL01391:Brms1 APN 19 5046695 missense possibly damaging 0.79
IGL02583:Brms1 APN 19 5046178 missense probably damaging 0.99
PIT4576001:Brms1 UTSW 19 5046201 missense probably damaging 1.00
R0054:Brms1 UTSW 19 5046699 nonsense probably null
R0054:Brms1 UTSW 19 5046699 nonsense probably null
R0670:Brms1 UTSW 19 5045971 missense probably damaging 1.00
R1757:Brms1 UTSW 19 5046407 missense probably damaging 1.00
R1962:Brms1 UTSW 19 5045999 missense probably damaging 0.97
R6963:Brms1 UTSW 19 5046653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGAGCCCCAGAATATACG -3'
(R):5'- CCCAAGCAGTGTGTCATACAG -3'

Sequencing Primer
(F):5'- ATATACGGAACCTCTTGGCG -3'
(R):5'- GCAGTGTGTCATACAGCAGCATC -3'
Posted On2019-05-15