Incidental Mutation 'R7136:Tbl2'
ID553060
Institutional Source Beutler Lab
Gene Symbol Tbl2
Ensembl Gene ENSMUSG00000005374
Gene Nametransducin (beta)-like 2
SynonymsC76179, WS-bTRP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7136 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135149657-135165760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 135149828 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 31 (W31G)
Ref Sequence ENSEMBL: ENSMUSP00000115011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005508] [ENSMUST00000139565] [ENSMUST00000152013] [ENSMUST00000153183] [ENSMUST00000201780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005508
AA Change: W31G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005508
Gene: ENSMUSG00000005374
AA Change: W31G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139565
AA Change: W31G
SMART Domains Protein: ENSMUSP00000120685
Gene: ENSMUSG00000005374
AA Change: W31G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152013
SMART Domains Protein: ENSMUSP00000118691
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
WD40 40 79 1.89e-9 SMART
Blast:WD40 87 126 3e-15 BLAST
WD40 138 177 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153183
AA Change: W31G

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115011
Gene: ENSMUSG00000005374
AA Change: W31G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Blast:WD40 122 161 5e-14 BLAST
WD40 173 212 1.67e-1 SMART
WD40 214 253 2.38e1 SMART
WD40 264 303 6.04e-8 SMART
Blast:WD40 313 353 4e-16 BLAST
WD40 358 395 1.28e0 SMART
coiled coil region 411 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201780
AA Change: W31G

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-transducin protein family. Most proteins of the beta-transducin family are involved in regulatory functions. This protein is possibly involved in some intracellular signaling pathway. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,466,631 D63E possibly damaging Het
1700123K08Rik A G 5: 138,562,348 S262P probably damaging Het
Abcc2 A G 19: 43,837,460 E1512G probably damaging Het
Abcg2 T G 6: 58,684,340 Y459D possibly damaging Het
Amy1 T C 3: 113,563,599 Y197C probably damaging Het
Bptf A G 11: 107,099,715 I516T probably damaging Het
Capn12 T A 7: 28,883,107 probably null Het
Cbln2 T A 18: 86,716,672 L190Q probably damaging Het
Ccdc157 C T 11: 4,148,592 E305K possibly damaging Het
Ccdc47 A G 11: 106,205,004 S289P probably benign Het
Chd3 C T 11: 69,348,438 E1756K probably null Het
Chrd G T 16: 20,734,522 A183S possibly damaging Het
Cp C T 3: 19,985,658 R880* probably null Het
Cyp24a1 A T 2: 170,494,143 D191E probably benign Het
Dnah1 T C 14: 31,298,656 Y1252C probably damaging Het
Eps8l1 A G 7: 4,477,404 D487G probably damaging Het
Fam227b T G 2: 126,124,028 Q159P probably damaging Het
Fat3 A G 9: 16,378,185 I14T probably benign Het
Fbxl19 C A 7: 127,750,045 T129N possibly damaging Het
Fuca2 T C 10: 13,505,921 F193L probably benign Het
Gm10037 A G 13: 67,842,992 probably null Het
H2-Q1 T C 17: 35,320,627 probably null Het
Hgh1 A G 15: 76,370,431 M336V probably benign Het
Il12b T C 11: 44,408,030 L104P probably benign Het
Kcnh2 A T 5: 24,332,991 F125I probably benign Het
Kcnk7 A G 19: 5,706,076 H110R probably benign Het
Kdm3a G A 6: 71,611,780 P415L probably benign Het
Kifc3 T C 8: 95,103,449 T610A probably benign Het
Lmbr1l C A 15: 98,911,491 probably null Het
Lmo7 T A 14: 101,920,539 M1436K unknown Het
Lrp1 C T 10: 127,558,622 C2574Y probably damaging Het
Med13l A G 5: 118,721,522 E258G possibly damaging Het
Mesp1 T C 7: 79,793,158 I124V probably damaging Het
Mrgpra2a A T 7: 47,427,186 I108N probably benign Het
Nos1 G T 5: 117,895,860 R349L possibly damaging Het
Olfr1356 T C 10: 78,847,781 I45V probably benign Het
Olfr195 C T 16: 59,148,964 T38I probably damaging Het
Osgin1 T A 8: 119,441,437 M1K probably null Het
Pde4dip C T 3: 97,694,063 S2346N probably benign Het
Pde7a T C 3: 19,231,094 M310V probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pink1 T C 4: 138,317,458 T323A probably damaging Het
Polr3a C T 14: 24,461,815 R891Q probably damaging Het
Prkar1b C A 5: 139,108,608 C75F probably benign Het
Prss58 C T 6: 40,900,053 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Qars T C 9: 108,512,772 I350T probably damaging Het
Qprt T C 7: 127,108,812 K149R probably damaging Het
Rasgrf1 T A 9: 89,991,598 D653E probably damaging Het
Rbm26 T C 14: 105,144,267 M481V possibly damaging Het
Rdx C T 9: 52,086,445 T573M probably damaging Het
Rgs14 A G 13: 55,379,695 probably null Het
Robo2 T C 16: 73,956,550 E813G probably damaging Het
Rrbp1 A T 2: 143,949,680 F1369I probably benign Het
Sh2d4b T A 14: 40,840,252 T319S probably benign Het
Slc7a15 G T 12: 8,538,895 N217K probably damaging Het
Stmn1 A G 4: 134,470,777 K42E probably damaging Het
Tmem8b T C 4: 43,669,845 C114R possibly damaging Het
Tsc2 T C 17: 24,613,280 S711G probably benign Het
Ttn T C 2: 76,836,560 R11531G unknown Het
Ube2e3 T C 2: 78,913,741 Y105H probably benign Het
Usp16 G T 16: 87,483,171 C753F probably benign Het
Vmn1r13 T C 6: 57,210,254 S133P possibly damaging Het
Vmn2r76 T A 7: 86,228,767 Q474L probably benign Het
Vps52 T C 17: 33,965,288 I601T probably benign Het
Wasf1 A T 10: 40,926,591 T81S possibly damaging Het
Wdr82 A G 9: 106,171,333 S39G probably benign Het
Zdhhc13 A G 7: 48,801,332 I108V probably benign Het
Other mutations in Tbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Tbl2 APN 5 135156363 unclassified probably benign
IGL02669:Tbl2 APN 5 135152998 missense probably damaging 1.00
R1160:Tbl2 UTSW 5 135159392 missense probably benign 0.01
R1909:Tbl2 UTSW 5 135152991 missense probably damaging 1.00
R1945:Tbl2 UTSW 5 135157600 missense possibly damaging 0.56
R2156:Tbl2 UTSW 5 135156520 critical splice donor site probably null
R2342:Tbl2 UTSW 5 135158753 missense possibly damaging 0.81
R2392:Tbl2 UTSW 5 135156514 missense probably benign 0.10
R3813:Tbl2 UTSW 5 135156521 critical splice donor site probably null
R5560:Tbl2 UTSW 5 135157591 nonsense probably null
R6301:Tbl2 UTSW 5 135159369 missense probably benign
R6723:Tbl2 UTSW 5 135159276 missense probably damaging 1.00
R6816:Tbl2 UTSW 5 135159215 splice site probably null
R7288:Tbl2 UTSW 5 135154399 missense possibly damaging 0.92
R7720:Tbl2 UTSW 5 135159475 missense probably damaging 1.00
X0024:Tbl2 UTSW 5 135159591 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATCGTAACGACTAGGTCCCG -3'
(R):5'- AAGAATCTTGTCCCTGGGGTG -3'

Sequencing Primer
(F):5'- CCAAAGAGGCCAACGCTGG -3'
(R):5'- TCCCTGGGGTGCACCTG -3'
Posted On2019-05-15