Incidental Mutation 'R7192:Dbr1'
ID559661
Institutional Source Beutler Lab
Gene Symbol Dbr1
Ensembl Gene ENSMUSG00000032469
Gene Namedebranching RNA lariats 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7192 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99575799-99584501 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 99576702 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066650] [ENSMUST00000139796] [ENSMUST00000148987]
Predicted Effect probably null
Transcript: ENSMUST00000066650
SMART Domains Protein: ENSMUSP00000070991
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:Metallophos 1 230 1.8e-11 PFAM
DBR1 235 380 8.27e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136884
SMART Domains Protein: ENSMUSP00000114670
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
DBR1 20 128 4.22e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138002
SMART Domains Protein: ENSMUSP00000119924
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:Metallophos 2 144 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139796
SMART Domains Protein: ENSMUSP00000115203
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:DBR1 52 82 1.8e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148987
SMART Domains Protein: ENSMUSP00000115074
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
DBR1 162 231 1.34e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156035
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA lariat debranching enzyme that hydrolyzes 2'-5' prime branched phosphodiester bonds. The encoded protein specifically targets the bonds at the branch point of excised lariat intron RNA, converting them to linear molecules that are then degraded. This protein may also be involved in retroviral replication. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit impaired class switch recombination in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Akap9 T A 5: 4,005,723 probably null Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Mertk A G 2: 128,793,108 probably null Het
Myo1b A G 1: 51,757,217 L1016P probably damaging Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Dbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Dbr1 APN 9 99575978 missense probably damaging 1.00
IGL01952:Dbr1 APN 9 99582412 missense possibly damaging 0.64
IGL01995:Dbr1 APN 9 99583899 missense probably benign 0.00
FR4340:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4342:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583674 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4548:Dbr1 UTSW 9 99583673 nonsense probably null
FR4589:Dbr1 UTSW 9 99583677 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583683 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583699 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583689 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583692 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583702 unclassified probably benign
PIT4131001:Dbr1 UTSW 9 99584019 unclassified probably null
R0100:Dbr1 UTSW 9 99583669 missense probably benign 0.01
R1240:Dbr1 UTSW 9 99584020 missense probably benign 0.44
R1502:Dbr1 UTSW 9 99582387 missense probably damaging 1.00
R2265:Dbr1 UTSW 9 99579410 missense probably damaging 1.00
R2279:Dbr1 UTSW 9 99580147 missense probably benign 0.06
R5202:Dbr1 UTSW 9 99583891 missense probably benign 0.00
R7012:Dbr1 UTSW 9 99583321 nonsense probably null
R7025:Dbr1 UTSW 9 99575983 missense probably damaging 1.00
R7037:Dbr1 UTSW 9 99576568 splice site probably null
R7350:Dbr1 UTSW 9 99582549 missense
R7396:Dbr1 UTSW 9 99583390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCAGACTTGCACTTCAC -3'
(R):5'- TTGCTTTAAGGCATCCCAGC -3'

Sequencing Primer
(F):5'- CTCAATGAATGTGTGCTCGAC -3'
(R):5'- GGCATTCACCACATGTCTT -3'
Posted On2019-06-26