Incidental Mutation 'R7369:Mfsd7a'
ID571991
Institutional Source Beutler Lab
Gene Symbol Mfsd7a
Ensembl Gene ENSMUSG00000029490
Gene Namemajor facilitator superfamily domain containing 7A
SynonymsMfsd7, 4732482E20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7369 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108441054-108448891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108445528 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000031455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031455]
Predicted Effect probably benign
Transcript: ENSMUST00000031455
AA Change: V148A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031455
Gene: ENSMUSG00000029490
AA Change: V148A

DomainStartEndE-ValueType
Pfam:MFS_1 36 396 8.9e-23 PFAM
transmembrane domain 423 445 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
B3gnt5 C A 16: 19,769,660 Q210K probably benign Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5a T C 8: 121,923,834 K157R probably benign Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdh6 A G 15: 13,042,638 V478A probably damaging Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
Dppa1 T A 11: 46,616,117 probably null Het
Dsp G T 13: 38,197,525 V2749F possibly damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Klf7 T C 1: 64,121,141 probably null Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mdn1 T A 4: 32,773,375 F5518L probably damaging Het
Msh3 T A 13: 92,299,262 T510S probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Tmem67 T C 4: 12,053,535 Y671C probably damaging Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in Mfsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Mfsd7a APN 5 108444592 splice site probably benign
R0239:Mfsd7a UTSW 5 108444016 splice site probably benign
R0551:Mfsd7a UTSW 5 108444465 splice site probably benign
R2086:Mfsd7a UTSW 5 108445621 missense probably damaging 1.00
R2240:Mfsd7a UTSW 5 108444707 missense probably benign 0.04
R4663:Mfsd7a UTSW 5 108442145 missense probably benign 0.01
R4713:Mfsd7a UTSW 5 108442079 missense probably damaging 0.97
R5560:Mfsd7a UTSW 5 108448863 start codon destroyed probably null 0.01
R5950:Mfsd7a UTSW 5 108445485 missense probably damaging 0.98
R6618:Mfsd7a UTSW 5 108443098 missense probably benign 0.16
R7107:Mfsd7a UTSW 5 108448715 splice site probably null
R7273:Mfsd7a UTSW 5 108441991 missense probably benign
R7384:Mfsd7a UTSW 5 108446060 missense probably damaging 0.96
R7502:Mfsd7a UTSW 5 108443780 intron probably null
R7585:Mfsd7a UTSW 5 108448819 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGAATCCTTCCTGGTTCAAG -3'
(R):5'- CCCTATAAGCTTGGGACAGG -3'

Sequencing Primer
(F):5'- CAAGCACTTTGGCCTTGGG -3'
(R):5'- ACAGGCATCTGAAGATTGGATGTCTC -3'
Posted On2019-09-13