Incidental Mutation 'R0647:Tiprl'
ID57237
Institutional Source Beutler Lab
Gene Symbol Tiprl
Ensembl Gene ENSMUSG00000040843
Gene NameTIP41, TOR signalling pathway regulator-like (S. cerevisiae)
Synonyms1810011K17Rik
MMRRC Submission 038832-MU
Accession Numbers

Genbank: NM_145513; MGI: 1915087

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0647 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165212286-165236996 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 165222523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043235] [ENSMUST00000192436] [ENSMUST00000195248]
Predicted Effect probably null
Transcript: ENSMUST00000043235
SMART Domains Protein: ENSMUSP00000037514
Gene: ENSMUSG00000040843

DomainStartEndE-ValueType
Pfam:TIP41 48 225 1.7e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142191
Predicted Effect probably benign
Transcript: ENSMUST00000192436
Predicted Effect probably benign
Transcript: ENSMUST00000195248
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A) (see PPP2CA; MIM 176915), PP4 (see PPP4C; MIM 602035), and PP6 (see PPP6C; MIM 612725) (McConnell et al., 2007 [PubMed 17384681]).[supplied by OMIM, Nov 2010]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T A 14: 8,536,655 D184V possibly damaging Het
Adamts2 C A 11: 50,603,438 T113K probably damaging Het
Adgre1 T A 17: 57,411,003 N338K probably damaging Het
Aggf1 A T 13: 95,371,656 probably null Het
Apc2 A T 10: 80,304,928 I206F probably damaging Het
Carmil3 T C 14: 55,502,435 probably null Het
Ccdc110 A C 8: 45,943,388 E772A probably damaging Het
Cdh23 A G 10: 60,307,902 F2977L probably damaging Het
Cdh23 A T 10: 60,323,374 Y2207* probably null Het
Chd4 T A 6: 125,109,123 N908K probably damaging Het
Chst9 A G 18: 15,452,669 I279T probably damaging Het
Ctnna3 A T 10: 63,820,424 N261I probably benign Het
Dlgap2 A T 8: 14,727,591 S279C possibly damaging Het
Dock4 G A 12: 40,710,884 E524K probably damaging Het
Fabp12 T A 3: 10,246,036 N122I possibly damaging Het
Fam184b T C 5: 45,584,590 T100A probably benign Het
Fbxl5 T C 5: 43,768,069 D176G probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Foxe1 A G 4: 46,344,477 N95S possibly damaging Het
Frem3 A G 8: 80,615,185 E1369G probably damaging Het
Frmpd4 C T X: 167,489,010 E483K probably damaging Het
Gbp11 T C 5: 105,330,964 K203E possibly damaging Het
Gm10334 A T 6: 41,443,341 F150L probably benign Het
Hs3st6 C T 17: 24,758,160 R205C probably damaging Het
Ifitm10 C T 7: 142,356,035 S179N probably damaging Het
Irx2 A C 13: 72,630,680 N121T probably damaging Het
Itih1 A T 14: 30,935,863 V417E probably damaging Het
Itpr1 A C 6: 108,383,698 E695A probably damaging Het
Kif1c T A 11: 70,726,141 I755K probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Lrp1 G C 10: 127,571,477 T1865R probably damaging Het
Lrrc8b T A 5: 105,480,607 I273K possibly damaging Het
Ly9 T C 1: 171,599,808 Y393C probably damaging Het
Mphosph8 T C 14: 56,674,405 V295A probably benign Het
Nlrp5 T A 7: 23,417,707 D269E probably damaging Het
Olfr1294 A G 2: 111,537,359 V310A probably benign Het
Olfr398 G A 11: 73,983,771 A279V probably damaging Het
Olfr469 T A 7: 107,823,011 I153F probably benign Het
Olfr654 T G 7: 104,588,115 F104V probably damaging Het
Olfr720 T G 14: 14,175,858 T75P probably benign Het
Otud3 A G 4: 138,913,637 L64P probably damaging Het
Pcdh17 A T 14: 84,447,773 H560L possibly damaging Het
Pcdhb21 T C 18: 37,513,860 V14A probably damaging Het
Rbfox1 A T 16: 7,224,384 Q14L probably damaging Het
Rbm44 A G 1: 91,156,928 D665G probably benign Het
Rc3h2 C T 2: 37,409,530 V163M probably damaging Het
Sash1 T A 10: 8,729,552 R1025W probably damaging Het
Sgpl1 A G 10: 61,113,488 S146P probably damaging Het
Slc27a2 G A 2: 126,587,916 D615N probably benign Het
Smap1 A G 1: 23,853,478 I135T probably damaging Het
Snapc3 A G 4: 83,450,229 D321G probably damaging Het
St6galnac4 C T 2: 32,589,448 R6C probably damaging Het
Syne2 C T 12: 75,888,203 P153L probably benign Het
Tmem94 A G 11: 115,796,795 N1160S probably damaging Het
Trim65 G A 11: 116,128,210 R168C possibly damaging Het
Txndc16 A T 14: 45,169,275 I241N probably damaging Het
Txndc16 T A 14: 45,165,361 R101* probably null Het
Ugt2b38 A G 5: 87,423,469 S235P probably benign Het
Ugt3a1 A T 15: 9,310,549 M306L probably benign Het
Vmn1r23 T A 6: 57,926,184 Y203F probably benign Het
Vmn2r3 T A 3: 64,275,625 I218F probably damaging Het
Wdfy4 A G 14: 33,109,699 C857R possibly damaging Het
Zfp493 A C 13: 67,783,875 K31T possibly damaging Het
Other mutations in Tiprl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Tiprl APN 1 165236746 missense probably damaging 1.00
3-1:Tiprl UTSW 1 165215828 missense possibly damaging 0.80
R0471:Tiprl UTSW 1 165222523 splice site probably null
R1413:Tiprl UTSW 1 165215790 missense possibly damaging 0.71
R1536:Tiprl UTSW 1 165228406 missense probably benign 0.00
R4232:Tiprl UTSW 1 165222587 missense probably damaging 0.99
R4997:Tiprl UTSW 1 165220190 missense possibly damaging 0.53
R5238:Tiprl UTSW 1 165215768 missense probably benign
R7972:Tiprl UTSW 1 165236974 unclassified probably benign
R8114:Tiprl UTSW 1 165228422 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CACTAAAATCCTAACTCCTGGGCCATTG -3'
(R):5'- TTCAGAGTGGAGGCAAATGTGAATACC -3'

Sequencing Primer
(F):5'- cctcttctgacctccaatgac -3'
(R):5'- CAAATGTGAATACCGATGCTATGC -3'
Posted On2013-07-11