Incidental Mutation 'R0647:Olfr469'
ID57263
Institutional Source Beutler Lab
Gene Symbol Olfr469
Ensembl Gene ENSMUSG00000095910
Gene Nameolfactory receptor 469
SynonymsMOR204-21, GA_x6K02T2PBJ9-10152980-10152036
MMRRC Submission 038832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0647 (G1)
Quality Score204
Status Not validated
Chromosome7
Chromosomal Location107820566-107825541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107823011 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 153 (I153F)
Ref Sequence ENSEMBL: ENSMUSP00000150486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075704] [ENSMUST00000213252]
Predicted Effect probably benign
Transcript: ENSMUST00000075704
AA Change: I153F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000075122
Gene: ENSMUSG00000095910
AA Change: I153F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.3e-53 PFAM
Pfam:7tm_1 44 293 2.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213252
AA Change: I153F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216431
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T A 14: 8,536,655 D184V possibly damaging Het
Adamts2 C A 11: 50,603,438 T113K probably damaging Het
Adgre1 T A 17: 57,411,003 N338K probably damaging Het
Aggf1 A T 13: 95,371,656 probably null Het
Apc2 A T 10: 80,304,928 I206F probably damaging Het
Carmil3 T C 14: 55,502,435 probably null Het
Ccdc110 A C 8: 45,943,388 E772A probably damaging Het
Cdh23 A G 10: 60,307,902 F2977L probably damaging Het
Cdh23 A T 10: 60,323,374 Y2207* probably null Het
Chd4 T A 6: 125,109,123 N908K probably damaging Het
Chst9 A G 18: 15,452,669 I279T probably damaging Het
Ctnna3 A T 10: 63,820,424 N261I probably benign Het
Dlgap2 A T 8: 14,727,591 S279C possibly damaging Het
Dock4 G A 12: 40,710,884 E524K probably damaging Het
Fabp12 T A 3: 10,246,036 N122I possibly damaging Het
Fam184b T C 5: 45,584,590 T100A probably benign Het
Fbxl5 T C 5: 43,768,069 D176G probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Foxe1 A G 4: 46,344,477 N95S possibly damaging Het
Frem3 A G 8: 80,615,185 E1369G probably damaging Het
Frmpd4 C T X: 167,489,010 E483K probably damaging Het
Gbp11 T C 5: 105,330,964 K203E possibly damaging Het
Gm10334 A T 6: 41,443,341 F150L probably benign Het
Hs3st6 C T 17: 24,758,160 R205C probably damaging Het
Ifitm10 C T 7: 142,356,035 S179N probably damaging Het
Irx2 A C 13: 72,630,680 N121T probably damaging Het
Itih1 A T 14: 30,935,863 V417E probably damaging Het
Itpr1 A C 6: 108,383,698 E695A probably damaging Het
Kif1c T A 11: 70,726,141 I755K probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Lrp1 G C 10: 127,571,477 T1865R probably damaging Het
Lrrc8b T A 5: 105,480,607 I273K possibly damaging Het
Ly9 T C 1: 171,599,808 Y393C probably damaging Het
Mphosph8 T C 14: 56,674,405 V295A probably benign Het
Nlrp5 T A 7: 23,417,707 D269E probably damaging Het
Olfr1294 A G 2: 111,537,359 V310A probably benign Het
Olfr398 G A 11: 73,983,771 A279V probably damaging Het
Olfr654 T G 7: 104,588,115 F104V probably damaging Het
Olfr720 T G 14: 14,175,858 T75P probably benign Het
Otud3 A G 4: 138,913,637 L64P probably damaging Het
Pcdh17 A T 14: 84,447,773 H560L possibly damaging Het
Pcdhb21 T C 18: 37,513,860 V14A probably damaging Het
Rbfox1 A T 16: 7,224,384 Q14L probably damaging Het
Rbm44 A G 1: 91,156,928 D665G probably benign Het
Rc3h2 C T 2: 37,409,530 V163M probably damaging Het
Sash1 T A 10: 8,729,552 R1025W probably damaging Het
Sgpl1 A G 10: 61,113,488 S146P probably damaging Het
Slc27a2 G A 2: 126,587,916 D615N probably benign Het
Smap1 A G 1: 23,853,478 I135T probably damaging Het
Snapc3 A G 4: 83,450,229 D321G probably damaging Het
St6galnac4 C T 2: 32,589,448 R6C probably damaging Het
Syne2 C T 12: 75,888,203 P153L probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Tmem94 A G 11: 115,796,795 N1160S probably damaging Het
Trim65 G A 11: 116,128,210 R168C possibly damaging Het
Txndc16 A T 14: 45,169,275 I241N probably damaging Het
Txndc16 T A 14: 45,165,361 R101* probably null Het
Ugt2b38 A G 5: 87,423,469 S235P probably benign Het
Ugt3a1 A T 15: 9,310,549 M306L probably benign Het
Vmn1r23 T A 6: 57,926,184 Y203F probably benign Het
Vmn2r3 T A 3: 64,275,625 I218F probably damaging Het
Wdfy4 A G 14: 33,109,699 C857R possibly damaging Het
Zfp493 A C 13: 67,783,875 K31T possibly damaging Het
Other mutations in Olfr469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02205:Olfr469 APN 7 107822591 missense probably damaging 1.00
IGL02252:Olfr469 APN 7 107823146 missense probably benign 0.04
R0365:Olfr469 UTSW 7 107822917 nonsense probably null
R0863:Olfr469 UTSW 7 107823374 missense probably benign
R1830:Olfr469 UTSW 7 107823371 missense probably benign 0.02
R2189:Olfr469 UTSW 7 107822615 missense probably benign 0.09
R2316:Olfr469 UTSW 7 107822800 missense probably benign 0.25
R6187:Olfr469 UTSW 7 107822574 missense probably benign
R6305:Olfr469 UTSW 7 107822657 missense probably benign 0.01
R6774:Olfr469 UTSW 7 107823188 missense probably benign 0.06
R7019:Olfr469 UTSW 7 107823158 missense probably benign 0.04
R7205:Olfr469 UTSW 7 107822575 missense probably benign 0.01
R7466:Olfr469 UTSW 7 107822922 nonsense probably null
R8128:Olfr469 UTSW 7 107823425 missense probably damaging 1.00
R8251:Olfr469 UTSW 7 107822569 missense probably damaging 0.98
R8252:Olfr469 UTSW 7 107822569 missense probably damaging 0.98
R8253:Olfr469 UTSW 7 107822569 missense probably damaging 0.98
Z1176:Olfr469 UTSW 7 107822993 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGGAACTATGGGGACATTGCTAC -3'
(R):5'- TACCTGGTGACTGTGTCTGGGAAC -3'

Sequencing Primer
(F):5'- TATGGGGACATTGCTACCTGAAC -3'
(R):5'- GACGTAGGCTACTCATCTACTG -3'
Posted On2013-07-11