Incidental Mutation 'R7391:Ppm1f'
ID 573466
Institutional Source Beutler Lab
Gene Symbol Ppm1f
Ensembl Gene ENSMUSG00000026181
Gene Name protein phosphatase 1F (PP2C domain containing)
Synonyms 4933427B07Rik, 1110021B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7391 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 16896469-16927364 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16914234 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 183 (S183T)
Ref Sequence ENSEMBL: ENSMUSP00000027373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027373] [ENSMUST00000232247]
AlphaFold Q8CGA0
Predicted Effect probably benign
Transcript: ENSMUST00000027373
AA Change: S183T

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027373
Gene: ENSMUSG00000026181
AA Change: S183T

DomainStartEndE-ValueType
Blast:PP2Cc 25 97 1e-16 BLAST
low complexity region 99 110 N/A INTRINSIC
PP2Cc 141 408 3.14e-79 SMART
PP2C_SIG 168 410 5.13e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232247
AA Change: S18T

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.2683 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are not detected at weaning. Mice heterozygous for a targeted mutation display hyperactivity and an increase in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef3 A T 10: 18,646,259 I673K probably benign Het
Arhgap32 C A 9: 32,181,939 T196K probably benign Het
Azi2 T A 9: 118,050,892 probably null Het
B3gnt2 A T 11: 22,836,482 C235* probably null Het
BC080695 T A 4: 143,572,306 L273H probably damaging Het
Capn5 C T 7: 98,131,219 V315M probably benign Het
Ccl24 T A 5: 135,570,822 R111S possibly damaging Het
Cdk9 A G 2: 32,712,071 V45A probably damaging Het
Cep162 G T 9: 87,248,494 S21* probably null Het
Chil3 T A 3: 106,164,180 Y56F probably damaging Het
Ctr9 T A 7: 111,043,171 L368* probably null Het
Ctss A G 3: 95,529,541 E45G probably benign Het
Cyp2c29 A T 19: 39,307,767 Q214L probably null Het
Cyp2d34 T A 15: 82,618,386 N183I probably benign Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Ermp1 C A 19: 29,627,068 probably null Het
Ermp1 T A 19: 29,627,069 probably null Het
Evi2 A G 11: 79,515,667 S361P probably benign Het
Ext2 T A 2: 93,730,267 K518M probably damaging Het
Fgl1 A C 8: 41,210,446 M15R probably benign Het
Fsip2 T G 2: 82,990,319 D5465E possibly damaging Het
Hdlbp A T 1: 93,431,061 I256N possibly damaging Het
Hmmr G T 11: 40,707,786 probably null Het
Hnrnpu T C 1: 178,337,078 Q165R unknown Het
Homer3 G A 8: 70,289,484 A132T probably benign Het
Ikbkap C A 4: 56,781,211 Q487H possibly damaging Het
Ikbkap T G 4: 56,781,212 Q487P probably benign Het
Kcnb1 T C 2: 167,105,450 R493G probably damaging Het
Kcnn3 A T 3: 89,609,471 T396S probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krtap4-1 A G 11: 99,627,984 S67P unknown Het
Lama4 G T 10: 39,087,387 probably null Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Mical2 A T 7: 112,320,609 E442V probably damaging Het
Muc16 C T 9: 18,639,536 V5154I probably benign Het
Nav3 A T 10: 109,703,456 M2028K probably benign Het
Ncr1 T A 7: 4,344,471 W249R possibly damaging Het
Neurod6 T C 6: 55,679,631 D7G probably damaging Het
Nwd1 A G 8: 72,662,418 E158G probably damaging Het
Olfr132 A T 17: 38,131,050 F47L probably benign Het
Olfr1328 A T 4: 118,934,001 N282K possibly damaging Het
Olfr1381 T C 11: 49,552,544 S266P probably damaging Het
Olfr1395 A G 11: 49,148,979 T241A probably damaging Het
Olfr33 T C 7: 102,713,982 N144D probably benign Het
Padi2 A G 4: 140,937,955 D457G probably benign Het
Parn C A 16: 13,668,006 probably null Het
Pcdh1 C T 18: 38,202,785 E266K possibly damaging Het
Pigr A G 1: 130,849,566 D703G probably damaging Het
Ppp2r5b T A 19: 6,228,514 Q455L probably benign Het
Ptpn13 C T 5: 103,540,981 S880L probably damaging Het
R3hdm4 T C 10: 79,911,109 K240R probably benign Het
Rin1 T C 19: 5,050,860 M1T probably null Het
Rundc3b T A 5: 8,559,455 M170L probably benign Het
Ryr3 A T 2: 112,780,977 probably null Het
Scn11a T C 9: 119,795,717 D513G probably damaging Het
Slc27a2 C A 2: 126,553,162 P3Q unknown Het
Slc4a8 A G 15: 100,784,862 I187M probably damaging Het
Slc6a11 A T 6: 114,238,461 I441F probably benign Het
Stx2 C T 5: 128,988,803 R263Q probably damaging Het
Svep1 A T 4: 58,145,185 W427R probably damaging Het
Tes T A 6: 17,096,167 H51Q probably damaging Het
Thnsl2 T C 6: 71,131,930 D299G probably damaging Het
Tmem30b T C 12: 73,545,928 S138G probably benign Het
Tmprss11c T A 5: 86,237,791 H274L probably damaging Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Ttc30a1 T C 2: 75,980,015 K575E probably benign Het
Unc13b A G 4: 43,216,459 I253V probably benign Het
Unc80 A G 1: 66,695,528 S3305G probably benign Het
Ush2a TCACC TC 1: 188,962,008 probably benign Het
Virma A G 4: 11,508,099 D267G probably damaging Het
Vmn1r46 C T 6: 89,976,625 S152L probably benign Het
Wdr90 T C 17: 25,846,528 N1621S probably benign Het
Zfhx3 G A 8: 108,947,843 A1842T probably damaging Het
Zfp583 A G 7: 6,316,499 S505P probably damaging Het
Zfp608 T C 18: 54,897,547 Y1107C possibly damaging Het
Zfp616 A G 11: 74,085,329 H808R probably benign Het
Zfp677 T C 17: 21,398,391 F570S possibly damaging Het
Zfp85 A T 13: 67,749,291 Y221N probably damaging Het
Other mutations in Ppm1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ppm1f APN 16 16923913 missense probably benign 0.03
IGL00495:Ppm1f APN 16 16910971 missense possibly damaging 0.87
IGL01024:Ppm1f APN 16 16923769 missense probably benign 0.05
IGL02076:Ppm1f APN 16 16914171 missense possibly damaging 0.93
IGL02332:Ppm1f APN 16 16914087 missense possibly damaging 0.72
IGL02422:Ppm1f APN 16 16917716 missense probably damaging 0.99
IGL02936:Ppm1f APN 16 16915236 missense probably damaging 1.00
IGL03118:Ppm1f APN 16 16914078 missense probably null 0.03
R0348:Ppm1f UTSW 16 16903390 start codon destroyed probably null 0.71
R0621:Ppm1f UTSW 16 16915308 missense probably benign 0.00
R0970:Ppm1f UTSW 16 16903593 critical splice donor site probably null
R1785:Ppm1f UTSW 16 16910970 missense probably benign
R1812:Ppm1f UTSW 16 16917787 missense probably damaging 1.00
R1988:Ppm1f UTSW 16 16923666 missense probably damaging 0.98
R2080:Ppm1f UTSW 16 16923880 missense possibly damaging 0.50
R3687:Ppm1f UTSW 16 16923883 missense probably damaging 0.96
R5456:Ppm1f UTSW 16 16923746 missense probably damaging 0.99
R7162:Ppm1f UTSW 16 16914193 missense probably damaging 1.00
R7290:Ppm1f UTSW 16 16910955 missense probably benign
R8492:Ppm1f UTSW 16 16915178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCATCAGTACTAGATGCC -3'
(R):5'- CCCAACGGTGGTACTCTTTG -3'

Sequencing Primer
(F):5'- TGGCACGGAGCTTCTTCAAC -3'
(R):5'- CCAACGGTGGTACTCTTTGAAGAC -3'
Posted On 2019-09-13