Incidental Mutation 'R7509:Cst7'
ID581935
Institutional Source Beutler Lab
Gene Symbol Cst7
Ensembl Gene ENSMUSG00000068129
Gene Namecystatin F (leukocystatin)
Synonymscystatin-like metastasis-associated protein, CMAP, Leukocystatin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7509 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150570415-150578944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150577704 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 97 (T97S)
Ref Sequence ENSEMBL: ENSMUSP00000086606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089200]
Predicted Effect probably benign
Transcript: ENSMUST00000089200
AA Change: T97S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000086606
Gene: ENSMUSG00000068129
AA Change: T97S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 33 144 1.04e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 A G 7: 119,534,388 S259G probably benign Het
Adamts16 G T 13: 70,787,164 N436K probably damaging Het
Asb3 T A 11: 30,998,507 M61K probably benign Het
Catspere2 A G 1: 178,077,512 T163A possibly damaging Het
Ccser2 A G 14: 36,938,645 L517P probably damaging Het
Cd226 A G 18: 89,247,071 T158A probably benign Het
Chd6 A T 2: 161,013,154 I778N probably damaging Het
Cnga4 T C 7: 105,406,890 V336A probably benign Het
Cpd C T 11: 76,797,876 V857I probably benign Het
Cpm A G 10: 117,659,840 Y78C probably damaging Het
Cttnbp2nl T C 3: 105,032,730 K8E possibly damaging Het
Erbb4 A T 1: 68,250,580 D767E possibly damaging Het
Esyt2 T C 12: 116,365,876 S685P probably damaging Het
Gcfc2 T C 6: 81,953,275 L641P probably damaging Het
Gcnt4 T A 13: 96,947,170 F325I probably benign Het
Glg1 T G 8: 111,259,043 S52R probably benign Het
Gm10577 G A 4: 101,020,651 L16F unknown Het
Gm14326 C T 2: 177,945,700 G501D probably benign Het
Gm1587 G A 14: 77,797,024 P35S unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grrp1 A C 4: 134,252,113 V18G probably damaging Het
Helb T A 10: 120,089,814 H886L probably damaging Het
Hgsnat A G 8: 25,955,726 V380A probably damaging Het
Hmbs T A 9: 44,336,911 R125S Het
Hsd17b4 A T 18: 50,164,682 Y346F probably damaging Het
Inpp4a T C 1: 37,387,830 L624P probably damaging Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Itga11 C T 9: 62,781,940 T1129I probably benign Het
Itih4 G A 14: 30,895,447 V575I probably benign Het
Kcnn2 A G 18: 45,683,120 T473A probably benign Het
Kidins220 T C 12: 24,982,361 V31A probably damaging Het
Lrch1 G A 14: 74,947,608 T18I probably benign Het
Ly6e T C 15: 74,958,286 F30L probably damaging Het
Med13l A G 5: 118,748,930 D1632G probably damaging Het
Mei4 T A 9: 82,025,577 L320Q probably damaging Het
Mlip T G 9: 77,181,396 T197P probably damaging Het
Mon2 G A 10: 123,032,552 A532V probably benign Het
Myh1 C T 11: 67,210,461 P688S probably benign Het
Ncapg G A 5: 45,696,108 D900N probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Ntn4 A G 10: 93,710,568 N361S probably benign Het
Nudt16l1 T A 16: 4,939,218 H26Q probably damaging Het
Obscn G A 11: 59,051,629 T4348I probably benign Het
Olfr898 T A 9: 38,349,572 M157K probably benign Het
Olfr960 T A 9: 39,623,327 I66N probably damaging Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pcdhb7 C A 18: 37,342,021 T70K possibly damaging Het
Pcdhga3 T A 18: 37,675,857 Y454* probably null Het
Pigc A T 1: 161,970,976 T176S probably benign Het
Pola2 A T 19: 5,961,166 S43R probably benign Het
Pole A T 5: 110,330,705 probably benign Het
Polq C A 16: 37,060,343 D956E probably benign Het
Polq T A 16: 37,060,344 C957S probably benign Het
Ppp3cc G A 14: 70,266,682 T107I probably damaging Het
Prss39 C A 1: 34,500,199 H173Q possibly damaging Het
Reep4 A G 14: 70,548,488 D256G probably benign Het
Rfc3 A G 5: 151,647,510 V107A probably damaging Het
Slc19a3 A G 1: 83,026,260 L40P probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Strada C A 11: 106,187,094 V15F unknown Het
Suco A T 1: 161,845,334 S440T probably damaging Het
Svep1 A T 4: 58,090,683 C1595S probably benign Het
Synpo G T 18: 60,603,494 T460K probably damaging Het
Tagap A T 17: 7,928,736 I93F probably damaging Het
Tmtc3 A T 10: 100,466,094 F331Y probably damaging Het
Tnpo1 A C 13: 98,870,243 I225M probably benign Het
Tollip A T 7: 141,892,141 M70K probably benign Het
Trpm7 A T 2: 126,849,922 I171N probably damaging Het
Ttc41 G T 10: 86,713,432 E163D probably damaging Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Vmn2r20 C T 6: 123,385,423 V801I probably benign Het
Vmn2r82 G A 10: 79,396,008 V614I possibly damaging Het
Vmn2r96 G A 17: 18,582,733 E302K probably benign Het
Vwf T C 6: 125,642,169 F1270S Het
Wdr3 A T 3: 100,151,187 F367L probably benign Het
Zfp592 A G 7: 81,038,340 S1005G probably damaging Het
Other mutations in Cst7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Cst7 UTSW 2 150575727 missense probably benign 0.01
R0530:Cst7 UTSW 2 150570515 start gained probably benign
R0606:Cst7 UTSW 2 150570519 start codon destroyed probably benign 0.08
R0620:Cst7 UTSW 2 150575886 splice site probably benign
R1856:Cst7 UTSW 2 150577708 missense probably damaging 1.00
R5556:Cst7 UTSW 2 150570568 missense probably benign
R7315:Cst7 UTSW 2 150570583 missense probably benign 0.00
R7487:Cst7 UTSW 2 150577704 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGAACTTGCCTCCCCAGTACTC -3'
(R):5'- GTCAGGTGGCATAGGTCATG -3'

Sequencing Primer
(F):5'- AGTACTCTCCTTACCTGCTTTAAGAC -3'
(R):5'- AACCCTGTGTCCCTCGAGAG -3'
Posted On2019-10-17