Incidental Mutation 'R7578:B3galt1'
ID586555
Institutional Source Beutler Lab
Gene Symbol B3galt1
Ensembl Gene ENSMUSG00000034780
Gene NameUDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Synonyms6330417G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7578 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location67565871-68122689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68118552 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 204 (T204A)
Ref Sequence ENSEMBL: ENSMUSP00000041343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042456] [ENSMUST00000112346] [ENSMUST00000180887]
Predicted Effect probably damaging
Transcript: ENSMUST00000042456
AA Change: T204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041343
Gene: ENSMUSG00000034780
AA Change: T204A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Galactosyl_T 92 283 5.4e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112346
AA Change: T204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107965
Gene: ENSMUSG00000034780
AA Change: T204A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Galactosyl_T 92 283 6.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180887
SMART Domains Protein: ENSMUSP00000137947
Gene: ENSMUSG00000034780

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is expressed exclusively in the brain. The encoded protein shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,183,533 V165E probably damaging Het
1700025G04Rik T G 1: 151,921,090 T75P probably benign Het
4930516K23Rik T C 7: 104,058,897 E235G probably benign Het
Adam15 A G 3: 89,344,192 C449R probably damaging Het
Adam24 T C 8: 40,680,255 V254A probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Aldh1a1 A C 19: 20,618,002 R98S probably damaging Het
Alg9 A G 9: 50,789,535 I202V probably benign Het
Anks1b G A 10: 90,049,927 E162K probably damaging Het
Armc4 A T 18: 7,211,593 D760E probably benign Het
Atp6v1b2 A G 8: 69,103,476 T268A probably benign Het
Atxn1 C T 13: 45,567,358 V354I probably benign Het
Catsperb T A 12: 101,588,285 I746K probably benign Het
Cdh23 G A 10: 60,407,407 T1063M probably benign Het
Cherp G A 8: 72,464,258 R543C Het
Cldn20 A G 17: 3,532,999 D149G probably damaging Het
Clk2 A G 3: 89,176,500 Q474R probably benign Het
Cp A G 3: 19,989,098 T1017A possibly damaging Het
Cyp2c39 T C 19: 39,510,956 L29P probably damaging Het
Dscr3 A C 16: 94,499,069 N275K probably damaging Het
Ebf3 C T 7: 137,313,532 V93M probably damaging Het
Eef1akmt1 T A 14: 57,549,871 M183L probably damaging Het
Fam160a1 G T 3: 85,665,898 L915I probably damaging Het
Fam71d T C 12: 78,715,501 probably null Het
Filip1l A G 16: 57,513,282 E146G probably damaging Het
Fpr-rs3 T C 17: 20,624,031 S283G possibly damaging Het
Fras1 A T 5: 96,684,437 Y1543F probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gjd3 A G 11: 98,982,475 V181A probably damaging Het
Gm49368 T A 7: 128,112,258 C711* probably null Het
Gtf3c2 A G 5: 31,172,997 S210P probably benign Het
Herc2 A G 7: 56,134,800 Y1404C probably benign Het
Il22ra2 T A 10: 19,631,624 D128E probably benign Het
Itgav T A 2: 83,747,875 D113E probably benign Het
Kcnd3 A G 3: 105,459,617 M268V probably benign Het
Kirrel3 G T 9: 34,939,112 G19V probably damaging Het
Klf17 T G 4: 117,760,719 Y147S possibly damaging Het
Leng1 C T 7: 3,665,383 R22H probably damaging Het
Lysmd4 T A 7: 67,226,289 Y233* probably null Het
Lyzl6 A G 11: 103,635,006 V96A probably benign Het
Mki67 T C 7: 135,700,915 T797A possibly damaging Het
Nuf2 G T 1: 169,504,528 H399Q probably benign Het
Nuggc T C 14: 65,648,174 V766A probably damaging Het
Oas1c A T 5: 120,802,179 D307E probably damaging Het
Olfr432 T A 1: 174,050,700 M109K possibly damaging Het
Olfr785 T C 10: 129,409,675 I103T probably damaging Het
P4ha3 T C 7: 100,293,914 Y169H probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkhd1 T C 1: 20,347,361 D2522G probably damaging Het
Prickle2 T C 6: 92,411,290 D433G probably benign Het
Ptcd3 A G 6: 71,908,707 S12P probably benign Het
Ptpn23 T A 9: 110,387,608 Q1060L probably benign Het
Rai14 G T 15: 10,574,828 N710K probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Satb2 A G 1: 56,871,784 V234A probably benign Het
Scg2 T C 1: 79,436,895 Q37R probably damaging Het
Slc35e3 A T 10: 117,740,579 S230T probably damaging Het
Slc39a2 T C 14: 51,895,416 V272A probably damaging Het
Smg7 T A 1: 152,845,430 Y677F probably damaging Het
Spinkl A G 18: 44,168,146 Y42H probably damaging Het
Srsf6 T C 2: 162,932,862 F102L probably benign Het
Sstr3 T C 15: 78,540,517 E10G probably benign Het
Tekt3 A T 11: 63,094,660 I431F probably damaging Het
Trio C T 15: 27,854,939 R778H possibly damaging Het
Ush2a T A 1: 188,549,913 V1875D probably damaging Het
Vmn2r29 A C 7: 7,231,442 I815S probably damaging Het
Vmn2r78 A T 7: 86,954,344 K577* probably null Het
Yes1 G A 5: 32,645,086 R115Q probably benign Het
Other mutations in B3galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:B3galt1 APN 2 68117976 missense possibly damaging 0.94
IGL00834:B3galt1 APN 2 68118706 missense probably damaging 1.00
IGL02555:B3galt1 APN 2 68118561 missense probably benign 0.41
IGL02678:B3galt1 APN 2 68118910 missense probably benign 0.28
IGL02904:B3galt1 APN 2 68118745 missense probably damaging 0.99
IGL02931:B3galt1 APN 2 68118384 missense probably damaging 1.00
IGL03231:B3galt1 APN 2 68118603 missense probably damaging 1.00
R0483:B3galt1 UTSW 2 68118588 missense probably benign
R0735:B3galt1 UTSW 2 68118579 missense possibly damaging 0.46
R4946:B3galt1 UTSW 2 68118569 missense possibly damaging 0.91
R5327:B3galt1 UTSW 2 68118768 missense probably damaging 1.00
R5638:B3galt1 UTSW 2 68118751 missense probably damaging 0.99
R6364:B3galt1 UTSW 2 68118672 missense probably damaging 1.00
R6960:B3galt1 UTSW 2 68118689 missense probably damaging 0.98
R8112:B3galt1 UTSW 2 68118358 missense probably damaging 1.00
R8115:B3galt1 UTSW 2 68117976 missense possibly damaging 0.83
Z1177:B3galt1 UTSW 2 68117990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGAGAGCCAGATCTTCC -3'
(R):5'- TCAAGATGAAGCAGCCTGG -3'

Sequencing Primer
(F):5'- ACATCATCGTGGAGGACTTC -3'
(R):5'- ATGAAGCAGCCTGGTGTGG -3'
Posted On2019-10-24