Incidental Mutation 'R7578:Itgav'
ID586556
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Nameintegrin alpha V
Synonymsalphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7578 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location83724397-83806916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83747875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000028499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740] [ENSMUST00000141725]
Predicted Effect probably benign
Transcript: ENSMUST00000028499
AA Change: D113E

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: D113E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111740
AA Change: D113E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: D113E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141725
AA Change: D112E

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122730
Gene: ENSMUSG00000027087
AA Change: D112E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 103 4.28e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,183,533 V165E probably damaging Het
1700025G04Rik T G 1: 151,921,090 T75P probably benign Het
4930516K23Rik T C 7: 104,058,897 E235G probably benign Het
Adam15 A G 3: 89,344,192 C449R probably damaging Het
Adam24 T C 8: 40,680,255 V254A probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Aldh1a1 A C 19: 20,618,002 R98S probably damaging Het
Alg9 A G 9: 50,789,535 I202V probably benign Het
Anks1b G A 10: 90,049,927 E162K probably damaging Het
Armc4 A T 18: 7,211,593 D760E probably benign Het
Atp6v1b2 A G 8: 69,103,476 T268A probably benign Het
Atxn1 C T 13: 45,567,358 V354I probably benign Het
B3galt1 A G 2: 68,118,552 T204A probably damaging Het
Catsperb T A 12: 101,588,285 I746K probably benign Het
Cdh23 G A 10: 60,407,407 T1063M probably benign Het
Cherp G A 8: 72,464,258 R543C Het
Cldn20 A G 17: 3,532,999 D149G probably damaging Het
Clk2 A G 3: 89,176,500 Q474R probably benign Het
Cp A G 3: 19,989,098 T1017A possibly damaging Het
Cyp2c39 T C 19: 39,510,956 L29P probably damaging Het
Dscr3 A C 16: 94,499,069 N275K probably damaging Het
Ebf3 C T 7: 137,313,532 V93M probably damaging Het
Eef1akmt1 T A 14: 57,549,871 M183L probably damaging Het
Fam160a1 G T 3: 85,665,898 L915I probably damaging Het
Fam71d T C 12: 78,715,501 probably null Het
Filip1l A G 16: 57,513,282 E146G probably damaging Het
Fpr-rs3 T C 17: 20,624,031 S283G possibly damaging Het
Fras1 A T 5: 96,684,437 Y1543F probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gjd3 A G 11: 98,982,475 V181A probably damaging Het
Gm49368 T A 7: 128,112,258 C711* probably null Het
Gtf3c2 A G 5: 31,172,997 S210P probably benign Het
Herc2 A G 7: 56,134,800 Y1404C probably benign Het
Il22ra2 T A 10: 19,631,624 D128E probably benign Het
Kcnd3 A G 3: 105,459,617 M268V probably benign Het
Kirrel3 G T 9: 34,939,112 G19V probably damaging Het
Klf17 T G 4: 117,760,719 Y147S possibly damaging Het
Leng1 C T 7: 3,665,383 R22H probably damaging Het
Lysmd4 T A 7: 67,226,289 Y233* probably null Het
Lyzl6 A G 11: 103,635,006 V96A probably benign Het
Mki67 T C 7: 135,700,915 T797A possibly damaging Het
Nuf2 G T 1: 169,504,528 H399Q probably benign Het
Nuggc T C 14: 65,648,174 V766A probably damaging Het
Oas1c A T 5: 120,802,179 D307E probably damaging Het
Olfr432 T A 1: 174,050,700 M109K possibly damaging Het
Olfr785 T C 10: 129,409,675 I103T probably damaging Het
P4ha3 T C 7: 100,293,914 Y169H probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pkhd1 T C 1: 20,347,361 D2522G probably damaging Het
Prickle2 T C 6: 92,411,290 D433G probably benign Het
Ptcd3 A G 6: 71,908,707 S12P probably benign Het
Ptpn23 T A 9: 110,387,608 Q1060L probably benign Het
Rai14 G T 15: 10,574,828 N710K probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Satb2 A G 1: 56,871,784 V234A probably benign Het
Scg2 T C 1: 79,436,895 Q37R probably damaging Het
Slc35e3 A T 10: 117,740,579 S230T probably damaging Het
Slc39a2 T C 14: 51,895,416 V272A probably damaging Het
Smg7 T A 1: 152,845,430 Y677F probably damaging Het
Spinkl A G 18: 44,168,146 Y42H probably damaging Het
Srsf6 T C 2: 162,932,862 F102L probably benign Het
Sstr3 T C 15: 78,540,517 E10G probably benign Het
Tekt3 A T 11: 63,094,660 I431F probably damaging Het
Trio C T 15: 27,854,939 R778H possibly damaging Het
Ush2a T A 1: 188,549,913 V1875D probably damaging Het
Vmn2r29 A C 7: 7,231,442 I815S probably damaging Het
Vmn2r78 A T 7: 86,954,344 K577* probably null Het
Yes1 G A 5: 32,645,086 R115Q probably benign Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83802995 missense probably damaging 1.00
IGL01969:Itgav APN 2 83803283 missense probably damaging 1.00
IGL02371:Itgav APN 2 83770053 missense probably damaging 1.00
IGL02563:Itgav APN 2 83771236 missense probably benign
IGL02640:Itgav APN 2 83791939 missense probably benign 0.33
IGL02641:Itgav APN 2 83768345 splice site probably benign
IGL02927:Itgav APN 2 83795540 missense probably damaging 1.00
IGL03172:Itgav APN 2 83765846 missense possibly damaging 0.51
R0158:Itgav UTSW 2 83792037 missense probably benign 0.33
R0346:Itgav UTSW 2 83792609 missense probably damaging 1.00
R0508:Itgav UTSW 2 83792658 splice site probably benign
R0546:Itgav UTSW 2 83803242 missense probably benign 0.04
R0554:Itgav UTSW 2 83794270 missense possibly damaging 0.95
R1122:Itgav UTSW 2 83791939 missense probably benign 0.33
R1468:Itgav UTSW 2 83765901 splice site probably benign
R1566:Itgav UTSW 2 83736630 missense probably damaging 1.00
R1657:Itgav UTSW 2 83801779 missense probably benign 0.21
R1892:Itgav UTSW 2 83771336 missense probably damaging 1.00
R1912:Itgav UTSW 2 83795486 missense possibly damaging 0.85
R2176:Itgav UTSW 2 83803255 missense probably damaging 1.00
R2438:Itgav UTSW 2 83776542 missense probably damaging 1.00
R2449:Itgav UTSW 2 83768750 critical splice donor site probably null
R3110:Itgav UTSW 2 83792571 nonsense probably null
R3112:Itgav UTSW 2 83792571 nonsense probably null
R3176:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3177:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3276:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3277:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3766:Itgav UTSW 2 83801885 critical splice donor site probably null
R3774:Itgav UTSW 2 83791964 missense probably damaging 1.00
R3880:Itgav UTSW 2 83768301 missense probably damaging 1.00
R4196:Itgav UTSW 2 83768327 missense probably benign 0.24
R4287:Itgav UTSW 2 83724840 nonsense probably null
R4620:Itgav UTSW 2 83755902 missense probably benign 0.07
R4790:Itgav UTSW 2 83755810 missense probably damaging 1.00
R4946:Itgav UTSW 2 83788983 missense probably benign 0.16
R6150:Itgav UTSW 2 83776436 missense probably benign
R6345:Itgav UTSW 2 83802036 missense probably damaging 1.00
R6482:Itgav UTSW 2 83794270 missense probably damaging 1.00
R6900:Itgav UTSW 2 83803247 missense probably damaging 1.00
R7247:Itgav UTSW 2 83724835 missense probably damaging 0.98
R7317:Itgav UTSW 2 83794983 missense probably benign 0.12
R7429:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7430:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7522:Itgav UTSW 2 83802029 missense probably benign 0.10
R7546:Itgav UTSW 2 83776550 nonsense probably null
R8311:Itgav UTSW 2 83765777 missense probably damaging 1.00
V1662:Itgav UTSW 2 83783854 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGCAGTGTAGGCAAAGTGAC -3'
(R):5'- TTTGATCAGAGGCCTGCAC -3'

Sequencing Primer
(F):5'- TAGACCAGGTTGGCTTTGAACTCAC -3'
(R):5'- TGATCAGAGGCCTGCACCAATG -3'
Posted On2019-10-24