Incidental Mutation 'R0241:Thop1'
ID59499
Institutional Source Beutler Lab
Gene Symbol Thop1
Ensembl Gene ENSMUSG00000004929
Gene Namethimet oligopeptidase 1
SynonymsEP24.15
MMRRC Submission 038479-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock #R0241 (G1)
Quality Score123
Status Validated
Chromosome10
Chromosomal Location81070035-81082559 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 81080245 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005057] [ENSMUST00000117422]
Predicted Effect probably benign
Transcript: ENSMUST00000005057
SMART Domains Protein: ENSMUSP00000005057
Gene: ENSMUSG00000004929

DomainStartEndE-ValueType
Pfam:Peptidase_M3 227 677 7e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117422
SMART Domains Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041

DomainStartEndE-ValueType
low complexity region 179 199 N/A INTRINSIC
BRLZ 237 301 4.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171484
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T A 6: 39,583,818 V380E probably benign Het
Anapc1 A T 2: 128,628,629 M1527K possibly damaging Het
Arfgef3 T A 10: 18,599,214 I1575F probably damaging Het
Atp4a G T 7: 30,717,135 G446C probably benign Het
Bicra A T 7: 15,975,145 M1188K probably damaging Het
Brd7 G A 8: 88,345,850 R331W probably benign Het
Cactin A G 10: 81,322,652 T151A probably benign Het
Cadps G A 14: 12,376,675 T1274M probably damaging Het
Catsper3 T C 13: 55,804,854 M175T probably damaging Het
Chd5 A G 4: 152,366,132 D605G probably damaging Het
Chst12 G A 5: 140,524,299 R227H possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cobl A T 11: 12,254,524 V644E probably benign Het
Ddx31 A G 2: 28,848,291 T155A probably damaging Het
Dnah3 T C 7: 119,922,730 Q4069R probably damaging Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Doc2b A G 11: 75,772,561 V355A probably damaging Het
Dock10 A T 1: 80,578,623 S578T probably benign Het
Duox1 T C 2: 122,333,397 probably benign Het
Epb41l5 T C 1: 119,567,779 probably null Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer2a A G 8: 3,688,796 probably null Het
Fmnl1 G A 11: 103,182,170 probably null Het
Fry A T 5: 150,260,346 probably benign Het
Git2 T C 5: 114,733,229 E208G probably damaging Het
Gm13757 A T 2: 88,446,545 M131K possibly damaging Het
Hs6st3 T C 14: 119,138,820 F136L probably benign Het
Hydin G A 8: 110,398,023 V555I probably benign Het
Kcns1 A T 2: 164,168,380 I153N probably damaging Het
Kmt2b A G 7: 30,577,069 L1726S probably damaging Het
Loxl3 A G 6: 83,050,133 D615G probably damaging Het
Negr1 T A 3: 157,208,399 probably benign Het
Nfasc C A 1: 132,636,993 A70S probably benign Het
Odf3l2 C T 10: 79,644,730 probably null Het
Olfr464 T A 11: 87,914,034 N291Y probably damaging Het
Olfr658 A G 7: 104,645,243 M41T probably benign Het
Olfr998 A G 2: 85,590,810 K90R probably benign Het
Otud7a T C 7: 63,697,244 probably benign Het
Pacs2 T C 12: 113,069,270 probably benign Het
Pde7b A G 10: 20,436,216 C239R probably damaging Het
Pdzd2 A T 15: 12,367,941 L2654Q probably damaging Het
Pgap1 T C 1: 54,535,951 probably null Het
Proz T A 8: 13,065,356 M124K probably benign Het
Raet1d A G 10: 22,371,429 T135A probably benign Het
Rapgef1 A G 2: 29,702,670 N558S possibly damaging Het
Rpl7 C G 1: 16,103,222 G101A possibly damaging Het
Sec14l1 G A 11: 117,147,098 probably benign Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Simc1 G T 13: 54,550,525 L1319F probably damaging Het
Sspo A G 6: 48,461,495 E1499G possibly damaging Het
Tango6 C T 8: 106,747,361 probably benign Het
Tas2r118 T C 6: 23,969,339 Y241C probably damaging Het
Tbck A G 3: 132,724,875 E344G probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmbim7 A T 5: 3,666,866 Y66F probably benign Het
Tmc8 C T 11: 117,786,381 probably benign Het
Tnfrsf19 A G 14: 60,973,592 S216P possibly damaging Het
Trappc2l A G 8: 122,614,393 probably benign Het
Trim67 A G 8: 124,823,190 R520G probably damaging Het
Ubp1 T A 9: 113,966,587 probably null Het
Vil1 T C 1: 74,426,694 L548P probably damaging Het
Wdr3 A G 3: 100,145,657 V593A probably damaging Het
Wdr5 A G 2: 27,533,013 Y243C probably damaging Het
Zan T C 5: 137,421,822 T2858A unknown Het
Zbtb37 A T 1: 161,020,369 V356E probably benign Het
Zfp36 C T 7: 28,378,334 V50I probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Thop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Thop1 APN 10 81078599 nonsense probably null
IGL00987:Thop1 APN 10 81081695 missense probably damaging 0.99
R0842:Thop1 UTSW 10 81075577 missense probably damaging 1.00
R1800:Thop1 UTSW 10 81073209 missense probably damaging 1.00
R1863:Thop1 UTSW 10 81073317 missense probably damaging 0.98
R2507:Thop1 UTSW 10 81070264 start codon destroyed probably null 0.47
R2905:Thop1 UTSW 10 81079591 missense probably damaging 1.00
R2930:Thop1 UTSW 10 81073314 missense probably damaging 0.98
R3898:Thop1 UTSW 10 81080444 missense probably damaging 1.00
R3899:Thop1 UTSW 10 81080444 missense probably damaging 1.00
R4911:Thop1 UTSW 10 81073291 missense probably damaging 1.00
R4924:Thop1 UTSW 10 81080194 missense probably benign 0.11
R4926:Thop1 UTSW 10 81073367 critical splice donor site probably null
R5092:Thop1 UTSW 10 81080578 missense probably damaging 1.00
R5968:Thop1 UTSW 10 81075559 missense probably benign 0.07
R6370:Thop1 UTSW 10 81077983 missense probably benign 0.00
R6733:Thop1 UTSW 10 81081412 missense probably damaging 0.98
R6853:Thop1 UTSW 10 81075661 critical splice donor site probably null
R7355:Thop1 UTSW 10 81075631 missense probably damaging 1.00
R7750:Thop1 UTSW 10 81080191 missense probably benign
R8030:Thop1 UTSW 10 81075616 missense possibly damaging 0.91
R8070:Thop1 UTSW 10 81079486 missense probably damaging 1.00
R8415:Thop1 UTSW 10 81078551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACATGCGCTACTACATGAAC -3'
(R):5'- AGTAGGTCTCCACCTCATCATGCTG -3'

Sequencing Primer
(F):5'- TATCGTGTGGACCAGAACCTG -3'
(R):5'- AATGTTCAGTGCCTGGCAGT -3'
Posted On2013-07-11