Incidental Mutation 'R7723:Apbb1ip'
ID595313
Institutional Source Beutler Lab
Gene Symbol Apbb1ip
Ensembl Gene ENSMUSG00000026786
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Synonyms9930118P07Rik, Prp48, proline-rich protein 48
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7723 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location22774094-22875653 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 22871562 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014290]
PDB Structure
Crystal structure of the Ras-associating and pleckstrin-homology domains of RIAM [X-RAY DIFFRACTION]
Crystal structure of RIAM RA-PH domains in complex with GTP bound Rap1 [X-RAY DIFFRACTION]
Crystal structure of RIAM TBS1 in complex with talin R7R8 domains [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000014290
SMART Domains Protein: ENSMUSP00000014290
Gene: ENSMUSG00000026786

DomainStartEndE-ValueType
PDB:3ZDL|B 1 31 1e-11 PDB
low complexity region 32 39 N/A INTRINSIC
coiled coil region 62 88 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
RA 179 266 1.15e-22 SMART
low complexity region 280 299 N/A INTRINSIC
PH 314 424 2.05e-10 SMART
low complexity region 516 532 N/A INTRINSIC
low complexity region 553 570 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 622 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy with no apparent defects in platelet integrin activation and function, hemostasis, or arterial thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brinp3 C T 1: 146,701,671 T148I probably damaging Het
C1qa A T 4: 136,896,433 C153* probably null Het
Camkk1 G T 11: 73,037,232 R363L probably benign Het
Ccdc80 T G 16: 45,126,435 probably null Het
Cenpu T C 8: 46,576,314 S351P probably damaging Het
Chd9 C T 8: 91,015,209 L1609F unknown Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Cyp3a59 A T 5: 146,079,344 I4F probably benign Het
Dph6 A G 2: 114,644,755 V93A probably damaging Het
Egf T A 3: 129,706,137 M785L probably benign Het
Fbn1 A T 2: 125,382,034 C598* probably null Het
Fer T C 17: 63,896,278 S68P probably damaging Het
Herc1 C T 9: 66,371,876 T22I probably benign Het
Kat2b A G 17: 53,638,387 D278G possibly damaging Het
Kdm1a C T 4: 136,557,749 V520I probably benign Het
Lrrc4c G T 2: 97,630,654 V542L possibly damaging Het
Lrrtm3 T C 10: 64,088,648 T247A possibly damaging Het
Macf1 T C 4: 123,432,924 S4929G probably benign Het
Mbd4 A T 6: 115,845,363 H428Q possibly damaging Het
Mink1 C G 11: 70,612,910 Q1183E probably benign Het
Myo9a C T 9: 59,779,858 P82L probably damaging Het
Nts T C 10: 102,484,923 T102A probably damaging Het
Nup35 T C 2: 80,656,031 I230T possibly damaging Het
Nwd2 A T 5: 63,808,004 T1644S possibly damaging Het
Nynrin T A 14: 55,872,045 N1536K possibly damaging Het
Olfr1174-ps A C 2: 88,311,475 V107G possibly damaging Het
Olfr168 A T 16: 19,530,608 L104* probably null Het
Olfr520 A G 7: 99,735,677 Y178C possibly damaging Het
Olfr62 A G 4: 118,665,717 S67G probably benign Het
Olfr976 A T 9: 39,956,624 Y104N possibly damaging Het
Palld C T 8: 61,711,458 V400I probably damaging Het
Pank2 T C 2: 131,280,338 V261A probably damaging Het
Pcdhb3 C A 18: 37,302,512 N510K probably damaging Het
Pfkfb2 A T 1: 130,707,588 Y79N probably damaging Het
Phc2 C T 4: 128,723,089 A385V probably benign Het
Prob1 T C 18: 35,652,889 T771A possibly damaging Het
Psmb6 T C 11: 70,526,570 V109A possibly damaging Het
Ptcd1 T C 5: 145,154,829 T487A probably damaging Het
Ralgapa1 A T 12: 55,741,513 M595K probably benign Het
Rps12 A T 10: 23,786,854 V14D probably benign Het
Scn3b C A 9: 40,288,397 S203* probably null Het
Serinc1 G A 10: 57,527,822 P15L probably benign Het
Six2 A G 17: 85,687,675 I93T probably benign Het
Slco1a1 T A 6: 141,909,069 I619F probably damaging Het
Snx25 A C 8: 46,038,479 V858G probably damaging Het
Sspo G A 6: 48,464,638 C1903Y probably damaging Het
Tas2r116 T A 6: 132,855,904 I156N probably benign Het
Tasp1 G T 2: 139,985,131 T189K probably damaging Het
Tdrd6 A T 17: 43,625,960 M1399K probably benign Het
Tecta C A 9: 42,366,936 C1092F probably damaging Het
Tmem150a G A 6: 72,359,074 V215I probably damaging Het
Tmem176b C T 6: 48,835,935 V109I probably benign Het
Trav8d-1 T A 14: 52,778,864 I69K probably damaging Het
Ttn A T 2: 76,808,075 L13954I probably damaging Het
Veph1 C A 3: 66,205,672 C237F possibly damaging Het
Vmn1r121 G A 7: 21,098,194 T107I probably damaging Het
Zdhhc13 G A 7: 48,808,819 M300I probably benign Het
Zfp608 T C 18: 54,897,601 D1089G probably damaging Het
Other mutations in Apbb1ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Apbb1ip APN 2 22858280 missense possibly damaging 0.59
IGL01447:Apbb1ip APN 2 22853182 missense probably damaging 1.00
IGL02987:Apbb1ip APN 2 22867637 nonsense probably null
IGL03329:Apbb1ip APN 2 22867717 missense possibly damaging 0.92
intelligence UTSW 2 22835931 missense probably damaging 1.00
psyops UTSW 2 22853120 nonsense probably null
Simulacrum UTSW 2 22866993 critical splice donor site probably null
R0374:Apbb1ip UTSW 2 22819705 splice site probably benign
R0842:Apbb1ip UTSW 2 22867666 missense possibly damaging 0.85
R1678:Apbb1ip UTSW 2 22874880 synonymous probably null
R3855:Apbb1ip UTSW 2 22875175 missense unknown
R3971:Apbb1ip UTSW 2 22823494 missense unknown
R4335:Apbb1ip UTSW 2 22871562 critical splice donor site probably null
R4569:Apbb1ip UTSW 2 22849544 missense probably damaging 1.00
R4742:Apbb1ip UTSW 2 22826916 missense unknown
R4804:Apbb1ip UTSW 2 22823598 critical splice donor site probably null
R4820:Apbb1ip UTSW 2 22875253 missense unknown
R4854:Apbb1ip UTSW 2 22853202 missense possibly damaging 0.94
R4899:Apbb1ip UTSW 2 22823349 missense unknown
R4920:Apbb1ip UTSW 2 22819684 missense unknown
R5283:Apbb1ip UTSW 2 22867671 missense probably benign 0.16
R5445:Apbb1ip UTSW 2 22835948 missense possibly damaging 0.90
R6346:Apbb1ip UTSW 2 22866993 critical splice donor site probably null
R6495:Apbb1ip UTSW 2 22853120 nonsense probably null
R6542:Apbb1ip UTSW 2 22874960 missense probably benign 0.04
R6550:Apbb1ip UTSW 2 22858233 missense probably damaging 1.00
R7011:Apbb1ip UTSW 2 22835931 missense probably damaging 1.00
R7304:Apbb1ip UTSW 2 22853135 synonymous probably null
R7554:Apbb1ip UTSW 2 22823546 missense unknown
R7690:Apbb1ip UTSW 2 22816984 missense unknown
R7831:Apbb1ip UTSW 2 22866921 missense probably damaging 1.00
R7861:Apbb1ip UTSW 2 22816978 missense unknown
R7914:Apbb1ip UTSW 2 22866921 missense probably damaging 1.00
R7944:Apbb1ip UTSW 2 22816978 missense unknown
X0014:Apbb1ip UTSW 2 22823554 small deletion probably benign
Z1177:Apbb1ip UTSW 2 22875103 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGCTTTGTATTTGCAGACTCTC -3'
(R):5'- AAAGCAGTGTCATTAATGGCTG -3'

Sequencing Primer
(F):5'- ATTTGCAGACTCTCCTTCAAACATAC -3'
(R):5'- TCTAGCCTCGGAAGCTTTATG -3'
Posted On2019-11-12