Incidental Mutation 'R4804:Apbb1ip'
ID370524
Institutional Source Beutler Lab
Gene Symbol Apbb1ip
Ensembl Gene ENSMUSG00000026786
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Synonyms9930118P07Rik, Prp48, proline-rich protein 48
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22774094-22875653 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 22823598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000014290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014290]
PDB Structure
Crystal structure of the Ras-associating and pleckstrin-homology domains of RIAM [X-RAY DIFFRACTION]
Crystal structure of RIAM RA-PH domains in complex with GTP bound Rap1 [X-RAY DIFFRACTION]
Crystal structure of RIAM TBS1 in complex with talin R7R8 domains [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000014290
SMART Domains Protein: ENSMUSP00000014290
Gene: ENSMUSG00000026786

DomainStartEndE-ValueType
PDB:3ZDL|B 1 31 1e-11 PDB
low complexity region 32 39 N/A INTRINSIC
coiled coil region 62 88 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
RA 179 266 1.15e-22 SMART
low complexity region 280 299 N/A INTRINSIC
PH 314 424 2.05e-10 SMART
low complexity region 516 532 N/A INTRINSIC
low complexity region 553 570 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 622 636 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148315
Meta Mutation Damage Score 0.9752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy with no apparent defects in platelet integrin activation and function, hemostasis, or arterial thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Apbb1ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Apbb1ip APN 2 22858280 missense possibly damaging 0.59
IGL01447:Apbb1ip APN 2 22853182 missense probably damaging 1.00
IGL02987:Apbb1ip APN 2 22867637 nonsense probably null
IGL03329:Apbb1ip APN 2 22867717 missense possibly damaging 0.92
intelligence UTSW 2 22835931 missense probably damaging 1.00
psyops UTSW 2 22853120 nonsense probably null
Simulacrum UTSW 2 22866993 critical splice donor site probably null
R0374:Apbb1ip UTSW 2 22819705 splice site probably benign
R0842:Apbb1ip UTSW 2 22867666 missense possibly damaging 0.85
R1678:Apbb1ip UTSW 2 22874880 synonymous probably null
R3855:Apbb1ip UTSW 2 22875175 missense unknown
R3971:Apbb1ip UTSW 2 22823494 missense unknown
R4335:Apbb1ip UTSW 2 22871562 critical splice donor site probably null
R4569:Apbb1ip UTSW 2 22849544 missense probably damaging 1.00
R4742:Apbb1ip UTSW 2 22826916 missense unknown
R4820:Apbb1ip UTSW 2 22875253 missense unknown
R4854:Apbb1ip UTSW 2 22853202 missense possibly damaging 0.94
R4899:Apbb1ip UTSW 2 22823349 missense unknown
R4920:Apbb1ip UTSW 2 22819684 missense unknown
R5283:Apbb1ip UTSW 2 22867671 missense probably benign 0.16
R5445:Apbb1ip UTSW 2 22835948 missense possibly damaging 0.90
R6346:Apbb1ip UTSW 2 22866993 critical splice donor site probably null
R6495:Apbb1ip UTSW 2 22853120 nonsense probably null
R6542:Apbb1ip UTSW 2 22874960 missense probably benign 0.04
R6550:Apbb1ip UTSW 2 22858233 missense probably damaging 1.00
R7011:Apbb1ip UTSW 2 22835931 missense probably damaging 1.00
R7304:Apbb1ip UTSW 2 22853135 synonymous probably null
R7554:Apbb1ip UTSW 2 22823546 missense unknown
R7690:Apbb1ip UTSW 2 22816984 missense unknown
R7723:Apbb1ip UTSW 2 22871562 critical splice donor site probably null
R7831:Apbb1ip UTSW 2 22866921 missense probably damaging 1.00
R7861:Apbb1ip UTSW 2 22816978 missense unknown
R7914:Apbb1ip UTSW 2 22866921 missense probably damaging 1.00
R7944:Apbb1ip UTSW 2 22816978 missense unknown
X0014:Apbb1ip UTSW 2 22823554 small deletion probably benign
Z1177:Apbb1ip UTSW 2 22875103 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTTCTGAGGGCTTCGGATG -3'
(R):5'- GTTCTCACCAAAACAGATGTTGAAG -3'

Sequencing Primer
(F):5'- TTCGGATGGCCAGGGTACAG -3'
(R):5'- CATCTGTGGTATTCAGTTACAGC -3'
Posted On2016-02-04