Incidental Mutation 'R7863:Il1rap'
ID607682
Institutional Source Beutler Lab
Gene Symbol Il1rap
Ensembl Gene ENSMUSG00000022514
Gene Nameinterleukin 1 receptor accessory protein
SynonymsIL-1RAcP, 6430709H04Rik, IL-1R AcP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7863 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location26581704-26730117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26676711 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 23 (R23C)
Ref Sequence ENSEMBL: ENSMUSP00000093843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023156] [ENSMUST00000096129] [ENSMUST00000166294] [ENSMUST00000174171] [ENSMUST00000174202]
Predicted Effect probably damaging
Transcript: ENSMUST00000023156
AA Change: R23C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023156
Gene: ENSMUSG00000022514
AA Change: R23C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 549 5.29e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096129
AA Change: R23C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514
AA Change: R23C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166294
AA Change: R23C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514
AA Change: R23C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174171
AA Change: R23C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133904
Gene: ENSMUSG00000022514
AA Change: R23C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
Blast:IG 251 312 1e-28 BLAST
low complexity region 316 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174202
AA Change: R23C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134202
Gene: ENSMUSG00000022514
AA Change: R23C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,947,274 S829P probably benign Het
A230050P20Rik G A 9: 20,871,376 A79T possibly damaging Het
Abca1 A T 4: 53,107,179 F183I probably benign Het
Abca12 A T 1: 71,293,497 M1235K probably damaging Het
Abca7 A G 10: 80,008,821 D1488G probably damaging Het
Adgrl3 A G 5: 81,512,749 Y387C probably damaging Het
Adnp T C 2: 168,189,350 K14E possibly damaging Het
Ago3 T C 4: 126,350,197 R721G possibly damaging Het
Aldh3b3 T A 19: 3,965,322 Y196* probably null Het
Alox12b T C 11: 69,166,927 W506R probably damaging Het
Arid4b A G 13: 14,164,149 I402V probably benign Het
Cep55 C T 19: 38,057,799 probably benign Het
Chl1 A G 6: 103,706,514 N767S possibly damaging Het
Cldn6 A G 17: 23,681,122 N20S probably benign Het
Col23a1 A T 11: 51,572,770 I420F probably damaging Het
Cxcr6 G A 9: 123,810,849 R312Q probably damaging Het
Cyp4a10 T C 4: 115,518,425 V35A probably benign Het
Def6 A G 17: 28,227,867 N548D possibly damaging Het
Dock6 A G 9: 21,846,658 V50A possibly damaging Het
Epha8 T A 4: 136,933,655 I639F probably damaging Het
Ephx2 T A 14: 66,107,243 R211* probably null Het
Espn C T 4: 152,152,159 V17M probably damaging Het
Ezr A G 17: 6,741,464 L403P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gm15448 C T 7: 3,824,802 probably null Het
Golm1 T C 13: 59,649,569 Y154C probably damaging Het
Gpam A G 19: 55,070,956 Y820H probably damaging Het
Gpr12 T C 5: 146,583,560 D184G possibly damaging Het
Gpr87 C T 3: 59,179,896 A63T probably damaging Het
Hmx2 G T 7: 131,554,353 G16V probably benign Het
Hspg2 T C 4: 137,564,824 V4009A probably benign Het
Iglc3 T C 16: 19,065,498 D61G not run Het
Ikzf2 G T 1: 69,570,637 Q144K possibly damaging Het
Kctd9 T A 14: 67,729,717 D161E possibly damaging Het
Klhl8 T C 5: 103,872,102 N351S probably benign Het
Krt28 G A 11: 99,365,173 T420I possibly damaging Het
March7 T A 2: 60,241,022 H623Q probably benign Het
Max A G 12: 76,940,074 I63T probably damaging Het
Mfsd7a A T 5: 108,445,534 L146Q probably damaging Het
Mrpl28 T A 17: 26,124,641 V125E possibly damaging Het
Mtmr10 T A 7: 64,319,457 D322E probably benign Het
Nlrp4f A T 13: 65,194,245 Y529N possibly damaging Het
Nlrx1 A G 9: 44,265,212 I31T probably benign Het
Oaz2 G A 9: 65,689,167 R171Q possibly damaging Het
Olfr1101 T G 2: 86,989,080 Y32S probably damaging Het
Olfr1226 T G 2: 89,193,951 I28L probably benign Het
Olfr76 T G 19: 12,120,610 D34A possibly damaging Het
Pcdhgc4 T A 18: 37,817,974 Y814* probably null Het
Pcm1 T A 8: 41,261,126 I243K probably damaging Het
Pdcd11 A T 19: 47,096,964 N171I probably damaging Het
Phf20l1 T A 15: 66,615,235 V400E possibly damaging Het
Psg28 T A 7: 18,428,117 T154S possibly damaging Het
Ptgs2 T A 1: 150,101,339 M99K probably damaging Het
Ptprh T A 7: 4,603,098 M1L probably benign Het
Rbp4 T C 19: 38,124,098 T140A possibly damaging Het
Rhbdd3 G A 11: 5,103,236 R12Q probably benign Het
Saal1 T C 7: 46,692,903 N372S probably benign Het
Satb1 T C 17: 51,805,322 E88G possibly damaging Het
Skiv2l2 T C 13: 112,908,901 T366A probably benign Het
Slc6a9 G T 4: 117,864,010 C319F probably damaging Het
Smc6 T G 12: 11,289,129 V322G probably benign Het
Snrnp200 T A 2: 127,231,689 F1336I probably damaging Het
Spg7 T A 8: 123,089,049 probably null Het
Stab2 G A 10: 86,972,881 T188I probably benign Het
Tbata A G 10: 61,175,742 E19G probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Ticrr T C 7: 79,682,012 V757A possibly damaging Het
Tle1 T C 4: 72,141,292 S261G probably null Het
Tlr3 T A 8: 45,397,737 I708L probably benign Het
Tph2 A C 10: 115,080,001 S422R probably damaging Het
Trim26 A G 17: 36,850,772 T28A probably damaging Het
Trmt10c A G 16: 56,035,191 L27S probably benign Het
Tubb6 T C 18: 67,401,720 S230P probably damaging Het
Usf1 C T 1: 171,417,817 Q266* probably null Het
Vegfa A G 17: 46,025,535 F220L probably damaging Het
Vmn2r105 C T 17: 20,208,675 C713Y probably benign Het
Vmn2r17 T A 5: 109,420,169 S53T probably benign Het
Xirp2 A T 2: 67,512,730 T1772S probably benign Het
Zfp462 T C 4: 55,007,747 I62T probably benign Het
Zfp516 T A 18: 83,001,328 I1157N probably benign Het
Zfp819 C A 7: 43,617,892 Q600K probably benign Het
Other mutations in Il1rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Il1rap APN 16 26722401 missense possibly damaging 0.77
IGL00976:Il1rap APN 16 26698839 missense probably benign 0.09
IGL01075:Il1rap APN 16 26680237 missense possibly damaging 0.94
IGL01665:Il1rap APN 16 26722713 missense probably damaging 1.00
IGL01962:Il1rap APN 16 26710568 nonsense probably null
IGL02101:Il1rap APN 16 26624182 missense possibly damaging 0.61
IGL02411:Il1rap APN 16 26710616 missense probably damaging 1.00
IGL03132:Il1rap APN 16 26680119 missense probably damaging 1.00
bacchus UTSW 16 26710632 critical splice donor site probably null
I1329:Il1rap UTSW 16 26692850 missense probably benign 0.07
LCD18:Il1rap UTSW 16 26631593 intron probably benign
PIT1430001:Il1rap UTSW 16 26710593 missense possibly damaging 0.53
R0302:Il1rap UTSW 16 26692794 missense probably benign 0.02
R0454:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R0481:Il1rap UTSW 16 26692835 missense probably damaging 1.00
R0612:Il1rap UTSW 16 26701105 missense possibly damaging 0.48
R0765:Il1rap UTSW 16 26710632 critical splice donor site probably null
R1552:Il1rap UTSW 16 26722434 missense possibly damaging 0.79
R1801:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R1867:Il1rap UTSW 16 26722926 missense probably damaging 1.00
R1942:Il1rap UTSW 16 26722455 missense probably damaging 1.00
R1996:Il1rap UTSW 16 26722493 missense probably benign 0.06
R2118:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2122:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2124:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R3104:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3105:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3106:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3891:Il1rap UTSW 16 26676856 missense probably damaging 1.00
R4133:Il1rap UTSW 16 26722886 missense probably benign 0.34
R4409:Il1rap UTSW 16 26712265 splice site probably null
R4610:Il1rap UTSW 16 26714776 missense probably benign 0.11
R4755:Il1rap UTSW 16 26722782 missense probably benign 0.20
R4776:Il1rap UTSW 16 26692799 missense possibly damaging 0.57
R4793:Il1rap UTSW 16 26695234 missense probably benign 0.09
R4811:Il1rap UTSW 16 26701238 critical splice donor site probably null
R4834:Il1rap UTSW 16 26676935 missense probably damaging 1.00
R5119:Il1rap UTSW 16 26624199 missense probably benign 0.01
R5744:Il1rap UTSW 16 26680224 missense probably benign 0.01
R6108:Il1rap UTSW 16 26722707 missense probably damaging 1.00
R6149:Il1rap UTSW 16 26712219 missense probably damaging 1.00
R6233:Il1rap UTSW 16 26710506 missense probably benign 0.24
R6246:Il1rap UTSW 16 26714881 missense probably benign
R6249:Il1rap UTSW 16 26692848 missense possibly damaging 0.88
R6254:Il1rap UTSW 16 26695270 missense probably benign
R6748:Il1rap UTSW 16 26722356 missense probably benign 0.02
R7151:Il1rap UTSW 16 26712128 missense probably damaging 1.00
R7794:Il1rap UTSW 16 26722908 missense probably benign
R7818:Il1rap UTSW 16 26698847 missense probably damaging 1.00
R7819:Il1rap UTSW 16 26722401 missense possibly damaging 0.77
R7946:Il1rap UTSW 16 26676711 missense probably damaging 1.00
X0027:Il1rap UTSW 16 26701147 missense probably benign 0.20
X0028:Il1rap UTSW 16 26676964 missense probably damaging 1.00
Z1176:Il1rap UTSW 16 26722399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGAGAGATTTCACAGTACC -3'
(R):5'- AGTTAATGGGCTCCTCCAGGTC -3'

Sequencing Primer
(F):5'- TGAGAGATTTCACAGTACCAAAAC -3'
(R):5'- TCCAGGTCCCGGTCTTG -3'
Posted On2019-12-20