Mutagenetix > Incidental Mutation

Incidental Mutation 'R7863:Golm1'

607675

Institutional Source

Beutler Lab

Gene Symbol

Golm1

Ensembl Gene

ENSMUSG00000021556

Gene Name

golgi membrane protein 1

Synonyms

2310001L02Rik, GP73, PSEC0257, D030064E01Rik, Golph2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R7863 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59634626-59675811 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59649569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 154 (Y154C)

Ref Sequence

ENSEMBL: ENSMUSP00000022039 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022039] [ENSMUST00000095739]

AlphaFold

Q91XA2

Predicted Effect

probably damaging
Transcript: ENSMUST00000022039
AA Change: Y154C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556
AA Change: Y154C

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
coiled coil region	40	144	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000095739
AA Change: Y154C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556
AA Change: Y154C

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
coiled coil region	40	144	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,947,274	S829P	probably benign	Het
A230050P20Rik	G	A	9: 20,871,376	A79T	possibly damaging	Het
Abca1	A	T	4: 53,107,179	F183I	probably benign	Het
Abca12	A	T	1: 71,293,497	M1235K	probably damaging	Het
Abca7	A	G	10: 80,008,821	D1488G	probably damaging	Het
Adgrl3	A	G	5: 81,512,749	Y387C	probably damaging	Het
Adnp	T	C	2: 168,189,350	K14E	possibly damaging	Het
Ago3	T	C	4: 126,350,197	R721G	possibly damaging	Het
Aldh3b3	T	A	19: 3,965,322	Y196*	probably null	Het
Alox12b	T	C	11: 69,166,927	W506R	probably damaging	Het
Arid4b	A	G	13: 14,164,149	I402V	probably benign	Het
Cep55	C	T	19: 38,057,799		probably benign	Het
Chl1	A	G	6: 103,706,514	N767S	possibly damaging	Het
Cldn6	A	G	17: 23,681,122	N20S	probably benign	Het
Col23a1	A	T	11: 51,572,770	I420F	probably damaging	Het
Cxcr6	G	A	9: 123,810,849	R312Q	probably damaging	Het
Cyp4a10	T	C	4: 115,518,425	V35A	probably benign	Het
Def6	A	G	17: 28,227,867	N548D	possibly damaging	Het
Dock6	A	G	9: 21,846,658	V50A	possibly damaging	Het
Epha8	T	A	4: 136,933,655	I639F	probably damaging	Het
Ephx2	T	A	14: 66,107,243	R211*	probably null	Het
Espn	C	T	4: 152,152,159	V17M	probably damaging	Het
Ezr	A	G	17: 6,741,464	L403P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gm15448	C	T	7: 3,824,802		probably null	Het
Gpam	A	G	19: 55,070,956	Y820H	probably damaging	Het
Gpr12	T	C	5: 146,583,560	D184G	possibly damaging	Het
Gpr87	C	T	3: 59,179,896	A63T	probably damaging	Het
Hmx2	G	T	7: 131,554,353	G16V	probably benign	Het
Hspg2	T	C	4: 137,564,824	V4009A	probably benign	Het
Iglc3	T	C	16: 19,065,498	D61G	not run	Het
Ikzf2	G	T	1: 69,570,637	Q144K	possibly damaging	Het
Il1rap	C	T	16: 26,676,711	R23C	probably damaging	Het
Kctd9	T	A	14: 67,729,717	D161E	possibly damaging	Het
Klhl8	T	C	5: 103,872,102	N351S	probably benign	Het
Krt28	G	A	11: 99,365,173	T420I	possibly damaging	Het
March7	T	A	2: 60,241,022	H623Q	probably benign	Het
Max	A	G	12: 76,940,074	I63T	probably damaging	Het
Mfsd7a	A	T	5: 108,445,534	L146Q	probably damaging	Het
Mrpl28	T	A	17: 26,124,641	V125E	possibly damaging	Het
Mtmr10	T	A	7: 64,319,457	D322E	probably benign	Het
Nlrp4f	A	T	13: 65,194,245	Y529N	possibly damaging	Het
Nlrx1	A	G	9: 44,265,212	I31T	probably benign	Het
Oaz2	G	A	9: 65,689,167	R171Q	possibly damaging	Het
Olfr1101	T	G	2: 86,989,080	Y32S	probably damaging	Het
Olfr1226	T	G	2: 89,193,951	I28L	probably benign	Het
Olfr76	T	G	19: 12,120,610	D34A	possibly damaging	Het
Pcdhgc4	T	A	18: 37,817,974	Y814*	probably null	Het
Pcm1	T	A	8: 41,261,126	I243K	probably damaging	Het
Pdcd11	A	T	19: 47,096,964	N171I	probably damaging	Het
Phf20l1	T	A	15: 66,615,235	V400E	possibly damaging	Het
Psg28	T	A	7: 18,428,117	T154S	possibly damaging	Het
Ptgs2	T	A	1: 150,101,339	M99K	probably damaging	Het
Ptprh	T	A	7: 4,603,098	M1L	probably benign	Het
Rbp4	T	C	19: 38,124,098	T140A	possibly damaging	Het
Rhbdd3	G	A	11: 5,103,236	R12Q	probably benign	Het
Saal1	T	C	7: 46,692,903	N372S	probably benign	Het
Satb1	T	C	17: 51,805,322	E88G	possibly damaging	Het
Skiv2l2	T	C	13: 112,908,901	T366A	probably benign	Het
Slc6a9	G	T	4: 117,864,010	C319F	probably damaging	Het
Smc6	T	G	12: 11,289,129	V322G	probably benign	Het
Snrnp200	T	A	2: 127,231,689	F1336I	probably damaging	Het
Spg7	T	A	8: 123,089,049		probably null	Het
Stab2	G	A	10: 86,972,881	T188I	probably benign	Het
Tbata	A	G	10: 61,175,742	E19G	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Ticrr	T	C	7: 79,682,012	V757A	possibly damaging	Het
Tle1	T	C	4: 72,141,292	S261G	probably null	Het
Tlr3	T	A	8: 45,397,737	I708L	probably benign	Het
Tph2	A	C	10: 115,080,001	S422R	probably damaging	Het
Trim26	A	G	17: 36,850,772	T28A	probably damaging	Het
Trmt10c	A	G	16: 56,035,191	L27S	probably benign	Het
Tubb6	T	C	18: 67,401,720	S230P	probably damaging	Het
Usf1	C	T	1: 171,417,817	Q266*	probably null	Het
Vegfa	A	G	17: 46,025,535	F220L	probably damaging	Het
Vmn2r105	C	T	17: 20,208,675	C713Y	probably benign	Het
Vmn2r17	T	A	5: 109,420,169	S53T	probably benign	Het
Xirp2	A	T	2: 67,512,730	T1772S	probably benign	Het
Zfp462	T	C	4: 55,007,747	I62T	probably benign	Het
Zfp516	T	A	18: 83,001,328	I1157N	probably benign	Het
Zfp819	C	A	7: 43,617,892	Q600K	probably benign	Het

Other mutations in Golm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01116:Golm1	APN	13	59649656	missense	probably damaging	0.99
IGL01327:Golm1	APN	13	59645144	missense	possibly damaging	0.95
IGL02348:Golm1	APN	13	59638377	missense	probably benign	0.00
R0047:Golm1	UTSW	13	59645100	missense	probably benign	0.03
R0047:Golm1	UTSW	13	59645100	missense	probably benign	0.03
R0458:Golm1	UTSW	13	59664364	missense	probably damaging	0.98
R0989:Golm1	UTSW	13	59640183	missense	probably benign	0.01
R1301:Golm1	UTSW	13	59638373	missense	probably damaging	0.99
R1804:Golm1	UTSW	13	59642389	critical splice acceptor site	probably null
R1905:Golm1	UTSW	13	59642251	missense	probably benign	0.04
R1940:Golm1	UTSW	13	59642237	splice site	probably benign
R2086:Golm1	UTSW	13	59645185	nonsense	probably null
R2513:Golm1	UTSW	13	59642258	missense	probably benign	0.01
R2887:Golm1	UTSW	13	59640230	missense	probably benign	0.00
R3903:Golm1	UTSW	13	59638340	missense	probably damaging	1.00
R4154:Golm1	UTSW	13	59642353	missense	probably benign	0.01
R5580:Golm1	UTSW	13	59642365	missense	probably benign	0.03
R6193:Golm1	UTSW	13	59645158	missense	probably benign	0.00
R6418:Golm1	UTSW	13	59665561	missense	probably damaging	1.00
R6594:Golm1	UTSW	13	59664227	missense	possibly damaging	0.79
R6604:Golm1	UTSW	13	59638383	missense	probably damaging	1.00
R6967:Golm1	UTSW	13	59649576	small deletion	probably benign
R6968:Golm1	UTSW	13	59649576	small deletion	probably benign
R6991:Golm1	UTSW	13	59649576	small deletion	probably benign
R6992:Golm1	UTSW	13	59649576	small deletion	probably benign
R6993:Golm1	UTSW	13	59649576	small deletion	probably benign
R6996:Golm1	UTSW	13	59642244	missense	probably benign	0.00
R7576:Golm1	UTSW	13	59645106	missense	probably benign	0.00
R7692:Golm1	UTSW	13	59640257	missense	probably benign	0.08
R7948:Golm1	UTSW	13	59664197	critical splice donor site	probably null
R9519:Golm1	UTSW	13	59645100	missense	probably benign
R9703:Golm1	UTSW	13	59649619	missense	probably benign	0.39
X0026:Golm1	UTSW	13	59638313	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGAACATATGCATGCATGTACAC -3'
(R):5'- TCAAGGTGCAGGCTTCTGTG -3'

Sequencing Primer
(F):5'- CATATGCATGCATGTACACAAATG -3'
(R):5'- TCTGTAGACCGGACTAGGTTCAAC -3'

Posted On

2019-12-20