Incidental Mutation 'R5744:Il1rap'
ID445735
Institutional Source Beutler Lab
Gene Symbol Il1rap
Ensembl Gene ENSMUSG00000022514
Gene Nameinterleukin 1 receptor accessory protein
SynonymsIL-1RAcP, 6430709H04Rik, IL-1R AcP
MMRRC Submission 043197-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5744 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location26581704-26730117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26680224 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 158 (I158L)
Ref Sequence ENSEMBL: ENSMUSP00000128100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023156] [ENSMUST00000096129] [ENSMUST00000166294] [ENSMUST00000174171] [ENSMUST00000174202]
Predicted Effect probably benign
Transcript: ENSMUST00000023156
AA Change: I158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023156
Gene: ENSMUSG00000022514
AA Change: I158L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 549 5.29e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096129
AA Change: I158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514
AA Change: I158L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166294
AA Change: I158L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514
AA Change: I158L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174171
AA Change: I158L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133904
Gene: ENSMUSG00000022514
AA Change: I158L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
Blast:IG 251 312 1e-28 BLAST
low complexity region 316 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174202
AA Change: I158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134202
Gene: ENSMUSG00000022514
AA Change: I158L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,346 I19V possibly damaging Het
Ascc3 T C 10: 50,710,881 I943T probably benign Het
Btaf1 T C 19: 37,004,490 V1640A probably benign Het
Cep250 T C 2: 155,981,474 F1015S possibly damaging Het
Cgnl1 G T 9: 71,630,675 probably null Het
Csgalnact2 C T 6: 118,126,236 G255E probably damaging Het
Ctla2a C T 13: 60,935,953 probably null Het
Dip2c A T 13: 9,568,405 I497F probably damaging Het
Eif3f C A 7: 108,938,417 T179K probably damaging Het
Frem2 A G 3: 53,655,959 F376L probably damaging Het
Gemin4 A T 11: 76,212,165 F590Y probably damaging Het
Gemin5 C A 11: 58,155,183 C433F possibly damaging Het
Gm7694 C T 1: 170,302,506 probably null Het
Gpr158 G A 2: 21,368,520 G89R probably damaging Het
Herc1 C T 9: 66,508,193 P4817S probably damaging Het
Hs6st3 T C 14: 119,138,440 L9P possibly damaging Het
Igdcc3 TGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGC 9: 65,141,488 probably benign Het
Itpr2 A G 6: 146,376,151 S640P probably damaging Het
Metrn A G 17: 25,795,237 V205A probably damaging Het
Mfhas1 C A 8: 35,589,482 D370E probably damaging Het
Mn1 T C 5: 111,420,536 S791P possibly damaging Het
Mtmr3 A G 11: 4,487,679 V925A possibly damaging Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Nol8 A G 13: 49,662,326 N619D possibly damaging Het
Nup214 T C 2: 32,010,296 L879P probably damaging Het
Olfr1353 T C 10: 78,970,183 F178S probably damaging Het
Olfr167 A G 16: 19,515,336 I100T probably benign Het
Olfr825 T C 10: 130,162,792 D178G possibly damaging Het
Plxna1 C T 6: 89,334,682 R947Q possibly damaging Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Reln A C 5: 22,106,083 S277R probably null Het
Sel1l A T 12: 91,809,980 I746N possibly damaging Het
Slc2a8 C T 2: 32,976,028 D291N probably benign Het
Slc7a5 T C 8: 121,888,382 N242S probably benign Het
Smco3 T C 6: 136,831,765 N37S probably damaging Het
Sult1c1 T A 17: 53,973,962 K38* probably null Het
Tfap2b T C 1: 19,219,221 M190T probably benign Het
Tnpo2 T A 8: 85,051,894 Y623* probably null Het
Tomm70a G T 16: 57,121,839 probably benign Het
Ttyh2 T C 11: 114,702,310 probably null Het
Zbtb10 A G 3: 9,264,563 Y327C probably damaging Het
Other mutations in Il1rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Il1rap APN 16 26722401 missense possibly damaging 0.77
IGL00976:Il1rap APN 16 26698839 missense probably benign 0.09
IGL01075:Il1rap APN 16 26680237 missense possibly damaging 0.94
IGL01665:Il1rap APN 16 26722713 missense probably damaging 1.00
IGL01962:Il1rap APN 16 26710568 nonsense probably null
IGL02101:Il1rap APN 16 26624182 missense possibly damaging 0.61
IGL02411:Il1rap APN 16 26710616 missense probably damaging 1.00
IGL03132:Il1rap APN 16 26680119 missense probably damaging 1.00
bacchus UTSW 16 26710632 critical splice donor site probably null
I1329:Il1rap UTSW 16 26692850 missense probably benign 0.07
LCD18:Il1rap UTSW 16 26631593 intron probably benign
PIT1430001:Il1rap UTSW 16 26710593 missense possibly damaging 0.53
R0302:Il1rap UTSW 16 26692794 missense probably benign 0.02
R0454:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R0481:Il1rap UTSW 16 26692835 missense probably damaging 1.00
R0612:Il1rap UTSW 16 26701105 missense possibly damaging 0.48
R0765:Il1rap UTSW 16 26710632 critical splice donor site probably null
R1552:Il1rap UTSW 16 26722434 missense possibly damaging 0.79
R1801:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R1867:Il1rap UTSW 16 26722926 missense probably damaging 1.00
R1942:Il1rap UTSW 16 26722455 missense probably damaging 1.00
R1996:Il1rap UTSW 16 26722493 missense probably benign 0.06
R2118:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2122:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2124:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R3104:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3105:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3106:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3891:Il1rap UTSW 16 26676856 missense probably damaging 1.00
R4133:Il1rap UTSW 16 26722886 missense probably benign 0.34
R4409:Il1rap UTSW 16 26712265 splice site probably null
R4610:Il1rap UTSW 16 26714776 missense probably benign 0.11
R4755:Il1rap UTSW 16 26722782 missense probably benign 0.20
R4776:Il1rap UTSW 16 26692799 missense possibly damaging 0.57
R4793:Il1rap UTSW 16 26695234 missense probably benign 0.09
R4811:Il1rap UTSW 16 26701238 critical splice donor site probably null
R4834:Il1rap UTSW 16 26676935 missense probably damaging 1.00
R5119:Il1rap UTSW 16 26624199 missense probably benign 0.01
R6108:Il1rap UTSW 16 26722707 missense probably damaging 1.00
R6149:Il1rap UTSW 16 26712219 missense probably damaging 1.00
R6233:Il1rap UTSW 16 26710506 missense probably benign 0.24
R6246:Il1rap UTSW 16 26714881 missense probably benign
R6249:Il1rap UTSW 16 26692848 missense possibly damaging 0.88
R6254:Il1rap UTSW 16 26695270 missense probably benign
R6748:Il1rap UTSW 16 26722356 missense probably benign 0.02
R7151:Il1rap UTSW 16 26712128 missense probably damaging 1.00
X0027:Il1rap UTSW 16 26701147 missense probably benign 0.20
X0028:Il1rap UTSW 16 26676964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGTCACTTAATGGTCACAGG -3'
(R):5'- CCATTTAACTCAACAGGCATTCAGTC -3'

Sequencing Primer
(F):5'- TGGTCACAGGAACTTGCAC -3'
(R):5'- TCAACAGGCATTCAGTCATTACC -3'
Posted On2016-11-21