Incidental Mutation 'R0158:Gm14496'
ID60911
Institutional Source Beutler Lab
Gene Symbol Gm14496
Ensembl Gene ENSMUSG00000098505
Gene Namepredicted gene 14496
Synonyms
MMRRC Submission 038438-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0158 (G1)
Quality Score94
Status Not validated
Chromosome2
Chromosomal Location181991226-182001766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 181997413 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 432 (V432E)
Ref Sequence ENSEMBL: ENSMUSP00000071670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071760]
Predicted Effect probably benign
Transcript: ENSMUST00000071760
AA Change: V432E

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071670
Gene: ENSMUSG00000098505
AA Change: V432E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 456 1.3e-30 PFAM
Pfam:NCD3G 508 562 1.9e-18 PFAM
Pfam:7tm_3 595 830 7.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089788
SMART Domains Protein: ENSMUSP00000087221
Gene: ENSMUSG00000053277

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.8e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184507
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 93% (79/85)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T G 1: 26,683,951 H716P probably damaging Het
9530053A07Rik A G 7: 28,155,492 I1848V probably damaging Het
Abcf3 C T 16: 20,552,566 R437C probably damaging Het
Abhd3 A G 18: 10,647,840 Y315H possibly damaging Het
Adam19 C T 11: 46,143,034 P891L probably damaging Het
Ampd1 T A 3: 103,091,730 Y400* probably null Het
Ap1g1 T C 8: 109,855,635 S724P probably benign Het
BC067074 T A 13: 113,369,153 L2272* probably null Het
Bst2 T A 8: 71,537,217 T71S possibly damaging Het
C3 A G 17: 57,224,851 probably null Het
Cacna2d1 C A 5: 16,361,817 probably benign Het
Cacna2d4 C T 6: 119,236,748 H43Y possibly damaging Het
Ccdc71 T G 9: 108,464,137 V383G probably benign Het
Cd109 A T 9: 78,688,932 Q849L possibly damaging Het
Cdkn2a A T 4: 89,276,767 H115Q possibly damaging Het
Ces1e T C 8: 93,219,429 E161G probably benign Het
Cggbp1 C T 16: 64,855,838 S89L possibly damaging Het
Crocc A T 4: 141,042,242 probably benign Het
Eef1akmt3 G A 10: 127,033,273 Q111* probably null Het
Exoc7 T C 11: 116,295,292 N361S probably benign Het
Fat2 G T 11: 55,296,185 S1278R probably benign Het
Fbxo42 A G 4: 141,200,329 N640S probably benign Het
Fbxw25 A G 9: 109,654,652 V164A possibly damaging Het
Foxs1 T C 2: 152,932,410 E241G probably damaging Het
Fras1 A T 5: 96,776,634 I3645F possibly damaging Het
Herc1 T A 9: 66,495,921 L4374* probably null Het
Hist1h3b T A 13: 23,752,710 C111S probably damaging Het
Ift122 T C 6: 115,924,484 probably benign Het
Itgav C A 2: 83,792,037 N654K probably benign Het
Itih5 T C 2: 10,234,992 probably benign Het
Jak2 C A 19: 29,311,757 T1103K probably benign Het
Kcnc4 C A 3: 107,458,604 C96F probably benign Het
Med13l C A 5: 118,742,449 S1202Y unknown Het
Mefv T C 16: 3,715,456 E317G possibly damaging Het
Ncoa2 T C 1: 13,152,384 T1226A probably benign Het
Nktr C T 9: 121,750,691 probably benign Het
Nudt5 G A 2: 5,862,303 V61M probably damaging Het
Olfr33 C T 7: 102,713,955 A153T probably benign Het
Palm2 A G 4: 57,709,649 D198G possibly damaging Het
Papd5 G A 8: 88,250,743 G391D probably damaging Het
Pcdhb2 A C 18: 37,297,230 Y752S probably damaging Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pnp2 G A 14: 50,964,304 R249H probably damaging Het
Rgs3 A T 4: 62,623,884 I32F probably damaging Het
Rnf139 A G 15: 58,898,878 T251A probably benign Het
Rnf41 A G 10: 128,438,235 E252G probably damaging Het
Rxfp2 T A 5: 150,051,628 F220Y probably benign Het
Sdcbp A G 4: 6,379,042 D43G possibly damaging Het
Serpina3f A G 12: 104,217,008 D43G probably damaging Het
Sftpc T C 14: 70,521,447 K154R probably null Het
Simc1 A G 13: 54,524,717 T293A probably benign Het
Skint6 A T 4: 113,184,814 probably benign Het
Slc6a15 T C 10: 103,389,347 probably benign Het
Ston2 A T 12: 91,740,602 I78N probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tiam1 C T 16: 89,793,001 probably benign Het
Tnfsf15 T C 4: 63,729,992 H137R possibly damaging Het
Tpte G A 8: 22,327,739 R247H possibly damaging Het
Trim2 T C 3: 84,210,169 probably benign Het
Ulk1 A T 5: 110,788,944 probably benign Het
Utp4 T G 8: 106,913,386 H442Q probably null Het
Vmn1r193 T A 13: 22,219,628 I65F probably damaging Het
Vps54 A T 11: 21,306,962 Q690L probably damaging Het
Ybx2 T C 11: 69,940,319 probably benign Het
Zbtb38 C T 9: 96,686,940 G697D possibly damaging Het
Zfp202 C T 9: 40,208,916 Q218* probably null Het
Zfp820 G A 17: 21,819,819 T176I probably benign Het
Other mutations in Gm14496
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Gm14496 APN 2 181995021 missense probably damaging 1.00
IGL01300:Gm14496 APN 2 182000960 missense probably damaging 1.00
IGL01328:Gm14496 APN 2 181995880 missense probably damaging 1.00
IGL01526:Gm14496 APN 2 181995665 missense probably benign 0.12
IGL01576:Gm14496 APN 2 181991371 missense possibly damaging 0.92
IGL01775:Gm14496 APN 2 182000332 missense probably benign 0.00
IGL02020:Gm14496 APN 2 181996089 missense possibly damaging 0.95
IGL02150:Gm14496 APN 2 181991347 missense probably damaging 0.99
IGL02170:Gm14496 APN 2 181996351 missense probably damaging 1.00
IGL02262:Gm14496 APN 2 181996012 missense probably damaging 1.00
IGL02398:Gm14496 APN 2 181996170 missense probably benign 0.09
IGL02414:Gm14496 APN 2 181991405 missense probably benign 0.03
IGL02541:Gm14496 APN 2 182000393 missense probably benign 0.29
IGL02741:Gm14496 APN 2 181991343 missense probably benign
IGL02933:Gm14496 APN 2 182000463 missense probably benign 0.15
IGL03214:Gm14496 APN 2 182000536 missense probably damaging 1.00
FR4342:Gm14496 UTSW 2 181995906 missense probably benign 0.01
R0271:Gm14496 UTSW 2 181995954 missense probably benign 0.44
R0611:Gm14496 UTSW 2 181995111 missense probably benign 0.00
R0833:Gm14496 UTSW 2 181996266 missense probably damaging 0.99
R0834:Gm14496 UTSW 2 181995687 missense probably benign 0.00
R0906:Gm14496 UTSW 2 182000515 missense probably damaging 0.98
R1298:Gm14496 UTSW 2 181996092 missense probably benign 0.39
R1500:Gm14496 UTSW 2 181991233 missense probably benign 0.21
R1585:Gm14496 UTSW 2 181996209 missense possibly damaging 0.79
R1610:Gm14496 UTSW 2 181996179 missense probably benign 0.01
R1627:Gm14496 UTSW 2 181998778 missense probably damaging 1.00
R1635:Gm14496 UTSW 2 182001044 missense possibly damaging 0.88
R1663:Gm14496 UTSW 2 181997437 missense probably benign 0.03
R1792:Gm14496 UTSW 2 181996153 missense probably benign 0.00
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1922:Gm14496 UTSW 2 182001004 missense probably benign 0.22
R2081:Gm14496 UTSW 2 182000479 missense probably damaging 1.00
R2102:Gm14496 UTSW 2 181991334 missense possibly damaging 0.88
R2176:Gm14496 UTSW 2 181991337 missense probably benign
R4154:Gm14496 UTSW 2 181995079 missense probably benign 0.01
R4789:Gm14496 UTSW 2 181995784 missense possibly damaging 0.85
R4873:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R4875:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R5020:Gm14496 UTSW 2 181991359 missense possibly damaging 0.67
R5354:Gm14496 UTSW 2 182000809 missense probably damaging 1.00
R5361:Gm14496 UTSW 2 182000354 missense probably benign 0.07
R5457:Gm14496 UTSW 2 181997608 missense probably damaging 0.96
R5589:Gm14496 UTSW 2 181995881 nonsense probably null
R5655:Gm14496 UTSW 2 181996182 missense probably benign 0.06
R6007:Gm14496 UTSW 2 181997530 missense probably benign 0.37
R6123:Gm14496 UTSW 2 181991227 start codon destroyed probably null 1.00
R6159:Gm14496 UTSW 2 181996257 missense probably benign 0.01
R6168:Gm14496 UTSW 2 182000957 missense probably damaging 1.00
R6454:Gm14496 UTSW 2 181996222 missense probably damaging 0.97
R6502:Gm14496 UTSW 2 182000593 missense probably benign 0.01
R6649:Gm14496 UTSW 2 181997476 missense possibly damaging 0.83
R6996:Gm14496 UTSW 2 181996204 missense probably damaging 1.00
R7043:Gm14496 UTSW 2 182000327 missense possibly damaging 0.70
R7317:Gm14496 UTSW 2 181995820 missense possibly damaging 0.56
R7354:Gm14496 UTSW 2 182000686 missense probably damaging 1.00
R7565:Gm14496 UTSW 2 181991257 missense possibly damaging 0.84
R7565:Gm14496 UTSW 2 182000837 missense probably damaging 0.99
R7669:Gm14496 UTSW 2 181995918 missense possibly damaging 0.95
R7828:Gm14496 UTSW 2 181991378 nonsense probably null
X0058:Gm14496 UTSW 2 181995986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGAAAAGGTGTCTCAACATTTCACCA -3'
(R):5'- AGTTGTTGACTCTGTGGAAAACAAGGT -3'

Sequencing Primer
(F):5'- tcagaaatccgcctgcc -3'
(R):5'- CTGTGGAAAACAAGGTAAATAGCTTC -3'
Posted On2013-07-24