Incidental Mutation 'R0657:Itgb1'
ID62575
Institutional Source Beutler Lab
Gene Symbol Itgb1
Ensembl Gene ENSMUSG00000025809
Gene Nameintegrin beta 1 (fibronectin receptor beta)
SynonymsGm9863, Fnrb, CD29, 4633401G24Rik, beta1 integrin
MMRRC Submission 038842-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0657 (G1)
Quality Score204
Status Validated
Chromosome8
Chromosomal Location128685654-128733200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 128722854 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 585 (Y585D)
Ref Sequence ENSEMBL: ENSMUSP00000087457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090006] [ENSMUST00000124826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090006
AA Change: Y585D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087457
Gene: ENSMUSG00000025809
AA Change: Y585D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PSI 26 76 3.01e-7 SMART
INB 34 464 2e-298 SMART
VWA 142 372 1.45e0 SMART
low complexity region 568 581 N/A INTRINSIC
Pfam:EGF_2 599 630 8.8e-8 PFAM
Integrin_B_tail 640 728 4.58e-37 SMART
transmembrane domain 729 751 N/A INTRINSIC
Integrin_b_cyt 752 798 3.43e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124826
SMART Domains Protein: ENSMUSP00000120026
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3VI4|D 21 51 2e-16 PDB
Blast:PSI 26 51 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149116
SMART Domains Protein: ENSMUSP00000119699
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
Pfam:Integrin_B_tail 1 39 1.9e-12 PFAM
transmembrane domain 40 62 N/A INTRINSIC
Integrin_b_cyt 63 109 8.77e-25 SMART
Meta Mutation Damage Score 0.8402 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants die at or soon after implantation. Tissue-specific knockouts exhibit skin blisters, hair-loss, brain and heart defects, and impaired immune responses, wound healing, and hematopoietic stem cell migration, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Aldh7a1 C T 18: 56,537,197 probably benign Het
BC049730 T A 7: 24,713,447 D93E probably benign Het
Bfsp1 A C 2: 143,827,650 probably benign Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Chd7 T C 4: 8,753,141 V546A probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
F13a1 A T 13: 36,968,105 D237E probably damaging Het
F8 T C X: 75,211,416 Q2124R possibly damaging Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hmgcs2 A G 3: 98,291,053 T91A probably benign Het
Huwe1 T C X: 151,919,928 I3463T probably benign Het
Iars T C 13: 49,702,519 Y289H probably damaging Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Kif14 C T 1: 136,469,102 T382I probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Ptch1 A G 13: 63,513,751 V1054A possibly damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Tars2 A T 3: 95,748,557 V289E probably benign Het
Tmem135 A T 7: 89,144,682 I384N probably damaging Het
Trip12 C T 1: 84,759,050 M816I probably benign Het
Ulk2 T C 11: 61,808,054 probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Itgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Itgb1 APN 8 128713918 splice site probably benign
IGL01407:Itgb1 APN 8 128722834 missense probably benign 0.08
IGL03025:Itgb1 APN 8 128722584 missense possibly damaging 0.96
Drystacked UTSW 8 128732054 missense possibly damaging 0.79
Jumble UTSW 8 128714116 missense probably damaging 1.00
PIT4377001:Itgb1 UTSW 8 128710383 missense probably damaging 1.00
R0136:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0244:Itgb1 UTSW 8 128717685 splice site probably benign
R0483:Itgb1 UTSW 8 128726167 missense possibly damaging 0.79
R0606:Itgb1 UTSW 8 128722372 unclassified probably benign
R0865:Itgb1 UTSW 8 128710251 critical splice acceptor site probably null
R1052:Itgb1 UTSW 8 128713305 missense probably damaging 1.00
R1429:Itgb1 UTSW 8 128717676 critical splice donor site probably null
R1589:Itgb1 UTSW 8 128705458 missense probably damaging 0.99
R1589:Itgb1 UTSW 8 128705459 missense possibly damaging 0.95
R1614:Itgb1 UTSW 8 128720065 missense probably damaging 1.00
R1672:Itgb1 UTSW 8 128732045 missense probably damaging 1.00
R1723:Itgb1 UTSW 8 128726038 missense probably damaging 0.98
R1865:Itgb1 UTSW 8 128720457 missense probably benign 0.01
R3786:Itgb1 UTSW 8 128713358 missense probably damaging 1.00
R4223:Itgb1 UTSW 8 128714143 missense probably damaging 1.00
R4756:Itgb1 UTSW 8 128717222 missense probably damaging 0.98
R4826:Itgb1 UTSW 8 128720308 missense probably damaging 1.00
R4880:Itgb1 UTSW 8 128716150 missense probably damaging 1.00
R5202:Itgb1 UTSW 8 128720010 missense probably damaging 0.99
R5682:Itgb1 UTSW 8 128727068 splice site probably null
R5935:Itgb1 UTSW 8 128713237 nonsense probably null
R6156:Itgb1 UTSW 8 128732054 missense possibly damaging 0.79
R6160:Itgb1 UTSW 8 128720283 missense possibly damaging 0.95
R6248:Itgb1 UTSW 8 128722421 missense possibly damaging 0.80
R6812:Itgb1 UTSW 8 128705410 splice site probably null
R6869:Itgb1 UTSW 8 128720035 missense probably benign 0.01
R7249:Itgb1 UTSW 8 128720404 missense probably benign 0.28
R7496:Itgb1 UTSW 8 128720305 missense probably benign
R7679:Itgb1 UTSW 8 128720448 missense probably damaging 0.99
R7787:Itgb1 UTSW 8 128727018 missense probably benign 0.32
R7800:Itgb1 UTSW 8 128713237 missense possibly damaging 0.89
R8015:Itgb1 UTSW 8 128722401 missense possibly damaging 0.79
R8687:Itgb1 UTSW 8 128716216 missense probably damaging 1.00
R8709:Itgb1 UTSW 8 128713406 intron probably benign
Z1088:Itgb1 UTSW 8 128713369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGAAGACATGGACGCTTACTGC -3'
(R):5'- TATGCTCTGCACAGACGCCAAG -3'

Sequencing Primer
(F):5'- CTGCGAGTGTGATAACTTCAACTG -3'
(R):5'- AGACGCCAAGGCAGGTC -3'
Posted On2013-07-30