Incidental Mutation 'R8115:Unc5cl'
ID631164
Institutional Source Beutler Lab
Gene Symbol Unc5cl
Ensembl Gene ENSMUSG00000043592
Gene Nameunc-5 family C-terminal like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8115 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location48454901-48539714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48467410 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 477 (S477P)
Ref Sequence ENSEMBL: ENSMUSP00000074159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074574] [ENSMUST00000161418] [ENSMUST00000162132] [ENSMUST00000162313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074574
AA Change: S477P

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074159
Gene: ENSMUSG00000043592
AA Change: S477P

DomainStartEndE-ValueType
Pfam:ZU5 103 195 5.9e-28 PFAM
DEATH 402 491 1.35e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161418
Predicted Effect probably benign
Transcript: ENSMUST00000161587
Predicted Effect probably benign
Transcript: ENSMUST00000162132
Predicted Effect probably benign
Transcript: ENSMUST00000162313
Predicted Effect probably benign
Transcript: ENSMUST00000162467
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 94.2%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T C 4: 35,218,763 Y32C Het
A1bg T G 15: 60,920,147 I211L probably benign Het
Abhd16b G A 2: 181,493,734 R143H possibly damaging Het
Abt1 T C 13: 23,422,232 E184G probably damaging Het
Aqp1 AGG AGGG 6: 55,345,513 probably null Het
Asxl3 G A 18: 22,517,585 R877Q probably damaging Het
B3galt1 A G 2: 68,117,976 T12A possibly damaging Het
Bcat1 G A 6: 145,010,093 P354L probably damaging Het
Cad T C 5: 31,060,927 F452L possibly damaging Het
Cadps2 T A 6: 23,328,898 I973F probably benign Het
Cenpq T C 17: 40,932,829 N43D probably damaging Het
Chd9 G T 8: 91,036,332 V2262L probably damaging Het
Cttnbp2nl G T 3: 105,006,086 Q161K probably damaging Het
D630003M21Rik A T 2: 158,216,590 H463Q probably benign Het
Defb1 C T 8: 21,794,484 H40Y probably benign Het
Dmrtb1 A T 4: 107,677,059 D186E probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efr3a T A 15: 65,866,795 F758I probably damaging Het
Fap A G 2: 62,519,041 I501T probably benign Het
Galr3 C T 15: 79,043,324 R322* probably null Het
Hrnr C A 3: 93,323,732 R426S unknown Het
Hsp90ab1 A T 17: 45,569,275 M476K possibly damaging Het
Igsf3 G T 3: 101,455,279 R872L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqsec3 T G 6: 121,473,030 R178S unknown Het
Itgbl1 T C 14: 123,857,543 C327R probably damaging Het
Itsn2 A T 12: 4,673,602 Q1179L possibly damaging Het
Kcnb2 T C 1: 15,711,627 *908R probably null Het
Kdm5b G T 1: 134,619,673 W1020L possibly damaging Het
Kpna3 C A 14: 61,370,918 V364L probably damaging Het
Lsm14a T C 7: 34,375,237 I93V probably benign Het
Mast2 A G 4: 116,435,447 S109P probably benign Het
Muc4 G A 16: 32,755,304 S1726N unknown Het
Myo7a T C 7: 98,066,446 D1477G probably damaging Het
Nostrin G A 2: 69,180,920 probably null Het
Oasl1 T A 5: 114,936,937 V352E probably damaging Het
Olfr459 T A 6: 41,771,538 T254S probably benign Het
Pafah1b1 A G 11: 74,684,493 V195A probably damaging Het
Pcdhb4 G A 18: 37,309,400 V588M probably damaging Het
Pcsk5 A G 19: 17,510,166 probably null Het
Peg10 A G 6: 4,756,707 I428V unknown Het
Pmfbp1 G A 8: 109,537,037 V824M probably damaging Het
Prkag3 T C 1: 74,747,959 R47G possibly damaging Het
Prl8a1 T A 13: 27,574,045 H227L probably benign Het
Prune2 A G 19: 17,123,924 D2264G probably benign Het
Psg28 A G 7: 18,430,386 Y134H probably benign Het
Rab3gap2 T A 1: 185,267,250 Y1019N possibly damaging Het
Rbm15 A T 3: 107,331,650 F477L probably damaging Het
Ric1 A T 19: 29,586,573 N576Y probably damaging Het
S1pr1 T A 3: 115,712,649 T99S probably benign Het
Serpinb9b G T 13: 33,035,548 V153F probably null Het
Sh2d3c A G 2: 32,725,264 E122G probably benign Het
Slc6a11 T A 6: 114,131,481 W69R probably damaging Het
Slco6c1 T A 1: 97,072,961 I539F probably damaging Het
Smgc G T 15: 91,849,119 probably null Het
Spata17 T C 1: 187,117,456 Y194C probably damaging Het
Tap1 A T 17: 34,193,319 probably null Het
Topbp1 T C 9: 103,320,541 S440P probably benign Het
Trpc6 T C 9: 8,609,981 L150P probably damaging Het
Ttll4 C T 1: 74,687,330 Q696* probably null Het
Ubash3b C T 9: 41,026,328 E447K probably damaging Het
Unc80 A G 1: 66,648,913 T2357A probably benign Het
Vmn1r58 A T 7: 5,410,342 S296R probably benign Het
Vmn2r85 G T 10: 130,425,951 N172K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yipf7 T A 5: 69,527,227 T82S probably benign Het
Zap70 A G 1: 36,781,206 S523G probably damaging Het
Zfp354a A G 11: 51,069,663 T233A probably benign Het
Other mutations in Unc5cl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01728:Unc5cl APN 17 48459963 missense probably damaging 1.00
IGL02227:Unc5cl APN 17 48459781 missense probably benign 0.44
IGL03013:Unc5cl APN 17 48465021 missense possibly damaging 0.74
R0960:Unc5cl UTSW 17 48459596 unclassified probably benign
R2255:Unc5cl UTSW 17 48459946 missense possibly damaging 0.59
R3821:Unc5cl UTSW 17 48459973 missense possibly damaging 0.95
R4177:Unc5cl UTSW 17 48462270 missense probably benign 0.06
R4469:Unc5cl UTSW 17 48459805 missense possibly damaging 0.57
R4864:Unc5cl UTSW 17 48459844 missense possibly damaging 0.93
R6539:Unc5cl UTSW 17 48465017 missense probably damaging 0.96
Z1177:Unc5cl UTSW 17 48460551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCAGCTTGCAAAGTCCC -3'
(R):5'- CAAAGGCATGGCACGGTATG -3'

Sequencing Primer
(F):5'- CCTTCCGGGGAGGTAGACAAG -3'
(R):5'- GGCATGGCCTCTTGAAGCAC -3'
Posted On2020-06-30