Incidental Mutation 'R8115:Prkag3'
ID631107
Institutional Source Beutler Lab
Gene Symbol Prkag3
Ensembl Gene ENSMUSG00000006542
Gene Nameprotein kinase, AMP-activated, gamma 3 non-catalytic subunit
SynonymsAMPKg3L, AMPKg3, AMPKg3S
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8115 (G1)
Quality Score222.009
Status Not validated
Chromosome1
Chromosomal Location74738922-74749221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74747959 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 47 (R47G)
Ref Sequence ENSEMBL: ENSMUSP00000080342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000159728] [ENSMUST00000160732] [ENSMUST00000162093] [ENSMUST00000188073]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081636
AA Change: R47G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542
AA Change: R47G

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113672
AA Change: R22G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542
AA Change: R22G

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159728
Predicted Effect possibly damaging
Transcript: ENSMUST00000160732
AA Change: R47G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542
AA Change: R47G

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162093
AA Change: R47G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125242
Gene: ENSMUSG00000006542
AA Change: R47G

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188073
AA Change: R47G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542
AA Change: R47G

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. It is dominantly expressed in skeletal muscle. Studies of the pig counterpart suggest that this subunit may play a key role in the regulation of energy metabolism in skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired glycogen synthesis after exercise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T C 4: 35,218,763 Y32C Het
A1bg T G 15: 60,920,147 I211L probably benign Het
Abhd16b G A 2: 181,493,734 R143H possibly damaging Het
Abt1 T C 13: 23,422,232 E184G probably damaging Het
Aqp1 AGG AGGG 6: 55,345,513 probably null Het
Asxl3 G A 18: 22,517,585 R877Q probably damaging Het
B3galt1 A G 2: 68,117,976 T12A possibly damaging Het
Bcat1 G A 6: 145,010,093 P354L probably damaging Het
Cad T C 5: 31,060,927 F452L possibly damaging Het
Cadps2 T A 6: 23,328,898 I973F probably benign Het
Cenpq T C 17: 40,932,829 N43D probably damaging Het
Chd9 G T 8: 91,036,332 V2262L probably damaging Het
Cttnbp2nl G T 3: 105,006,086 Q161K probably damaging Het
D630003M21Rik A T 2: 158,216,590 H463Q probably benign Het
Defb1 C T 8: 21,794,484 H40Y probably benign Het
Dmrtb1 A T 4: 107,677,059 D186E probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efr3a T A 15: 65,866,795 F758I probably damaging Het
Fap A G 2: 62,519,041 I501T probably benign Het
Galr3 C T 15: 79,043,324 R322* probably null Het
Hrnr C A 3: 93,323,732 R426S unknown Het
Hsp90ab1 A T 17: 45,569,275 M476K possibly damaging Het
Igsf3 G T 3: 101,455,279 R872L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqsec3 T G 6: 121,473,030 R178S unknown Het
Itgbl1 T C 14: 123,857,543 C327R probably damaging Het
Itsn2 A T 12: 4,673,602 Q1179L possibly damaging Het
Kcnb2 T C 1: 15,711,627 *908R probably null Het
Kdm5b G T 1: 134,619,673 W1020L possibly damaging Het
Kpna3 C A 14: 61,370,918 V364L probably damaging Het
Lsm14a T C 7: 34,375,237 I93V probably benign Het
Mast2 A G 4: 116,435,447 S109P probably benign Het
Muc4 G A 16: 32,755,304 S1726N unknown Het
Myo7a T C 7: 98,066,446 D1477G probably damaging Het
Nostrin G A 2: 69,180,920 probably null Het
Oasl1 T A 5: 114,936,937 V352E probably damaging Het
Olfr459 T A 6: 41,771,538 T254S probably benign Het
Pafah1b1 A G 11: 74,684,493 V195A probably damaging Het
Pcdhb4 G A 18: 37,309,400 V588M probably damaging Het
Pcsk5 A G 19: 17,510,166 probably null Het
Peg10 A G 6: 4,756,707 I428V unknown Het
Pmfbp1 G A 8: 109,537,037 V824M probably damaging Het
Prl8a1 T A 13: 27,574,045 H227L probably benign Het
Prune2 A G 19: 17,123,924 D2264G probably benign Het
Psg28 A G 7: 18,430,386 Y134H probably benign Het
Rab3gap2 T A 1: 185,267,250 Y1019N possibly damaging Het
Rbm15 A T 3: 107,331,650 F477L probably damaging Het
Ric1 A T 19: 29,586,573 N576Y probably damaging Het
S1pr1 T A 3: 115,712,649 T99S probably benign Het
Serpinb9b G T 13: 33,035,548 V153F probably null Het
Sh2d3c A G 2: 32,725,264 E122G probably benign Het
Slc6a11 T A 6: 114,131,481 W69R probably damaging Het
Slco6c1 T A 1: 97,072,961 I539F probably damaging Het
Smgc G T 15: 91,849,119 probably null Het
Spata17 T C 1: 187,117,456 Y194C probably damaging Het
Topbp1 T C 9: 103,320,541 S440P probably benign Het
Trpc6 T C 9: 8,609,981 L150P probably damaging Het
Ttll4 C T 1: 74,687,330 Q696* probably null Het
Ubash3b C T 9: 41,026,328 E447K probably damaging Het
Unc5cl T C 17: 48,467,410 S477P possibly damaging Het
Unc80 A G 1: 66,648,913 T2357A probably benign Het
Vmn1r58 A T 7: 5,410,342 S296R probably benign Het
Vmn2r85 G T 10: 130,425,951 N172K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yipf7 T A 5: 69,527,227 T82S probably benign Het
Zap70 A G 1: 36,781,206 S523G probably damaging Het
Zfp354a A G 11: 51,069,663 T233A probably benign Het
Other mutations in Prkag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Prkag3 APN 1 74748812 splice site probably benign
IGL02139:Prkag3 APN 1 74740724 missense probably benign 0.14
P0023:Prkag3 UTSW 1 74740739 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0256:Prkag3 UTSW 1 74741171 missense probably benign 0.01
R0547:Prkag3 UTSW 1 74744720 critical splice donor site probably null
R1314:Prkag3 UTSW 1 74747184 missense probably damaging 1.00
R1484:Prkag3 UTSW 1 74740760 missense probably damaging 1.00
R2842:Prkag3 UTSW 1 74741175 missense probably benign 0.30
R4739:Prkag3 UTSW 1 74740705 makesense probably null
R5159:Prkag3 UTSW 1 74741487 missense probably damaging 1.00
R5876:Prkag3 UTSW 1 74748816 critical splice donor site probably benign
R5989:Prkag3 UTSW 1 74741274 missense probably benign 0.00
R7444:Prkag3 UTSW 1 74747266 missense probably benign 0.00
R7553:Prkag3 UTSW 1 74744735 missense probably damaging 1.00
R7630:Prkag3 UTSW 1 74744735 missense probably damaging 1.00
R8084:Prkag3 UTSW 1 74747207 missense probably damaging 1.00
Z1177:Prkag3 UTSW 1 74748025 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCGTTTAGGGAGGCAGAGG -3'
(R):5'- TTCCCATTTACAATACGTATCTTGG -3'

Sequencing Primer
(F):5'- CACAAGGTGAGACTGTGTTTAAGTCC -3'
(R):5'- TAGAAAACAAGAAATATTTGGGGAGG -3'
Posted On2020-06-30