Incidental Mutation 'R8115:D630003M21Rik'
ID631116
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene NameRIKEN cDNA D630003M21 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8115 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location158182533-158229222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158216590 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 463 (H463Q)
Ref Sequence ENSEMBL: ENSMUSP00000040546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]
Predicted Effect probably benign
Transcript: ENSMUST00000046944
AA Change: H463Q

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: H463Q

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 1e-6 BLAST
SCOP:d1aua_2 567 711 5e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103121
AA Change: H463Q

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: H463Q

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169335
AA Change: H463Q

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: H463Q

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T C 4: 35,218,763 Y32C Het
A1bg T G 15: 60,920,147 I211L probably benign Het
Abhd16b G A 2: 181,493,734 R143H possibly damaging Het
Abt1 T C 13: 23,422,232 E184G probably damaging Het
Aqp1 AGG AGGG 6: 55,345,513 probably null Het
Asxl3 G A 18: 22,517,585 R877Q probably damaging Het
B3galt1 A G 2: 68,117,976 T12A possibly damaging Het
Bcat1 G A 6: 145,010,093 P354L probably damaging Het
Cad T C 5: 31,060,927 F452L possibly damaging Het
Cadps2 T A 6: 23,328,898 I973F probably benign Het
Cenpq T C 17: 40,932,829 N43D probably damaging Het
Chd9 G T 8: 91,036,332 V2262L probably damaging Het
Cttnbp2nl G T 3: 105,006,086 Q161K probably damaging Het
Defb1 C T 8: 21,794,484 H40Y probably benign Het
Dmrtb1 A T 4: 107,677,059 D186E probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efr3a T A 15: 65,866,795 F758I probably damaging Het
Fap A G 2: 62,519,041 I501T probably benign Het
Galr3 C T 15: 79,043,324 R322* probably null Het
Hrnr C A 3: 93,323,732 R426S unknown Het
Hsp90ab1 A T 17: 45,569,275 M476K possibly damaging Het
Igsf3 G T 3: 101,455,279 R872L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqsec3 T G 6: 121,473,030 R178S unknown Het
Itgbl1 T C 14: 123,857,543 C327R probably damaging Het
Itsn2 A T 12: 4,673,602 Q1179L possibly damaging Het
Kcnb2 T C 1: 15,711,627 *908R probably null Het
Kdm5b G T 1: 134,619,673 W1020L possibly damaging Het
Kpna3 C A 14: 61,370,918 V364L probably damaging Het
Lsm14a T C 7: 34,375,237 I93V probably benign Het
Mast2 A G 4: 116,435,447 S109P probably benign Het
Muc4 G A 16: 32,755,304 S1726N unknown Het
Myo7a T C 7: 98,066,446 D1477G probably damaging Het
Nostrin G A 2: 69,180,920 probably null Het
Oasl1 T A 5: 114,936,937 V352E probably damaging Het
Olfr459 T A 6: 41,771,538 T254S probably benign Het
Pafah1b1 A G 11: 74,684,493 V195A probably damaging Het
Pcdhb4 G A 18: 37,309,400 V588M probably damaging Het
Pcsk5 A G 19: 17,510,166 probably null Het
Peg10 A G 6: 4,756,707 I428V unknown Het
Pmfbp1 G A 8: 109,537,037 V824M probably damaging Het
Prkag3 T C 1: 74,747,959 R47G possibly damaging Het
Prl8a1 T A 13: 27,574,045 H227L probably benign Het
Prune2 A G 19: 17,123,924 D2264G probably benign Het
Psg28 A G 7: 18,430,386 Y134H probably benign Het
Rab3gap2 T A 1: 185,267,250 Y1019N possibly damaging Het
Rbm15 A T 3: 107,331,650 F477L probably damaging Het
Ric1 A T 19: 29,586,573 N576Y probably damaging Het
S1pr1 T A 3: 115,712,649 T99S probably benign Het
Serpinb9b G T 13: 33,035,548 V153F probably null Het
Sh2d3c A G 2: 32,725,264 E122G probably benign Het
Slc6a11 T A 6: 114,131,481 W69R probably damaging Het
Slco6c1 T A 1: 97,072,961 I539F probably damaging Het
Smgc G T 15: 91,849,119 probably null Het
Spata17 T C 1: 187,117,456 Y194C probably damaging Het
Topbp1 T C 9: 103,320,541 S440P probably benign Het
Trpc6 T C 9: 8,609,981 L150P probably damaging Het
Ttll4 C T 1: 74,687,330 Q696* probably null Het
Ubash3b C T 9: 41,026,328 E447K probably damaging Het
Unc5cl T C 17: 48,467,410 S477P possibly damaging Het
Unc80 A G 1: 66,648,913 T2357A probably benign Het
Vmn1r58 A T 7: 5,410,342 S296R probably benign Het
Vmn2r85 G T 10: 130,425,951 N172K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Yipf7 T A 5: 69,527,227 T82S probably benign Het
Zap70 A G 1: 36,781,206 S523G probably damaging Het
Zfp354a A G 11: 51,069,663 T233A probably benign Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158213412 missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158217356 missense probably benign
IGL01501:D630003M21Rik APN 2 158201067 missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158204724 missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158203210 missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158210171 missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158217488 missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158216810 missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158200998 missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158217285 missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158216744 missense probably benign
IGL03148:D630003M21Rik APN 2 158217224 missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158217648 missense probably benign
F5770:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158196575 missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158203067 splice site probably benign
R0513:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158195407 intron probably benign
R1594:D630003M21Rik UTSW 2 158211630 missense probably damaging 1.00
R1774:D630003M21Rik UTSW 2 158220470 missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158217557 missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158203185 missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158208421 missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158215849 missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158204711 missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158201011 missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158195472 intron probably benign
R3937:D630003M21Rik UTSW 2 158200360 missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158196593 missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158216703 missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158196139 missense probably benign
R4947:D630003M21Rik UTSW 2 158186196 missense unknown
R5005:D630003M21Rik UTSW 2 158211643 missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158217633 missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158205745 missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158201035 missense probably benign 0.06
R5488:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5489:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158220511 missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158220392 splice site probably null
R5770:D630003M21Rik UTSW 2 158195580 intron probably benign
R5789:D630003M21Rik UTSW 2 158216814 missense possibly damaging 0.63
R5817:D630003M21Rik UTSW 2 158196493 missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158204657 splice site probably null
R5969:D630003M21Rik UTSW 2 158217708 missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158217584 missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158213448 missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158217401 missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158215951 missense probably benign 0.34
R6350:D630003M21Rik UTSW 2 158220495 missense probably damaging 1.00
R6548:D630003M21Rik UTSW 2 158205699 critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158220516 missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158204774 missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158216750 missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158216012 critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158217209 missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158200224 missense probably damaging 1.00
R7514:D630003M21Rik UTSW 2 158217353 missense probably damaging 1.00
R7587:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
R7587:D630003M21Rik UTSW 2 158201056 missense probably damaging 1.00
R7713:D630003M21Rik UTSW 2 158216778 nonsense probably null
R7792:D630003M21Rik UTSW 2 158210162 missense possibly damaging 0.94
R7819:D630003M21Rik UTSW 2 158216798 missense probably damaging 0.97
R7832:D630003M21Rik UTSW 2 158217668 missense probably damaging 1.00
V7580:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTCTGCACCAAGATATAAGTCTGC -3'
(R):5'- TGCAAAAGCCTGTGGGAATG -3'

Sequencing Primer
(F):5'- GCACCAAGATATAAGTCTGCCTTTG -3'
(R):5'- ATGCCAGAAGCCATGGTTC -3'
Posted On2020-06-30