Incidental Mutation 'R8184:Gne'
ID634763
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8184 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44084061 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 13 (Y13C)
Ref Sequence ENSEMBL: ENSMUSP00000030201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000144985]
Predicted Effect probably benign
Transcript: ENSMUST00000030201
AA Change: Y13C

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: Y13C

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144985
SMART Domains Protein: ENSMUSP00000118443
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 71 213 1.3e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl T C 2: 93,855,741 K577R probably benign Het
Amica1 T A 9: 45,088,812 L136Q probably damaging Het
Baiap3 A G 17: 25,248,525 S368P probably benign Het
Brf2 T C 8: 27,123,985 E391G possibly damaging Het
Casr T A 16: 36,509,746 M409L probably benign Het
Ccdc83 G T 7: 90,224,078 Y356* probably null Het
Clec10a A T 11: 70,169,816 N166Y probably damaging Het
Copg1 T C 6: 87,890,014 F77S probably damaging Het
Dnah7a T G 1: 53,627,035 K611T probably benign Het
Dock10 G A 1: 80,552,752 H1025Y probably damaging Het
Dock6 A T 9: 21,830,300 S876T possibly damaging Het
Dopey2 G T 16: 93,776,993 R1701L probably benign Het
Dus4l A G 12: 31,640,818 F278S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fbxo43 C T 15: 36,162,339 V241I possibly damaging Het
Gbx2 A T 1: 89,928,828 I280N probably damaging Het
Gm9573 A G 17: 35,622,830 S155P unknown Het
Gnai1 A G 5: 18,291,506 F140L Het
Heatr5b A T 17: 78,814,233 S688T probably benign Het
Hectd2 T A 19: 36,604,354 D431E possibly damaging Het
Hecw2 A G 1: 54,040,387 S36P probably benign Het
Hpx A T 7: 105,592,145 I353N probably damaging Het
Ints8 A T 4: 11,204,534 V974E probably damaging Het
Kazn A G 4: 142,118,130 V381A probably benign Het
Krt79 T C 15: 101,929,752 T523A unknown Het
Lrrc8e T G 8: 4,235,140 L455R probably damaging Het
Mrps11 T C 7: 78,783,377 S7P possibly damaging Het
Neurl3 A G 1: 36,269,581 F50S probably damaging Het
Nlgn1 T C 3: 25,436,199 T455A probably damaging Het
Pbp2 T C 6: 135,310,262 Y29C probably damaging Het
Pdcd11 T A 19: 47,113,352 L992* probably null Het
Pla2g6 A G 15: 79,287,122 I756T probably benign Het
Polm T A 11: 5,831,707 D263V possibly damaging Het
Pspc1 T C 14: 56,764,243 T225A probably benign Het
Rtca C A 3: 116,507,824 A25S probably benign Het
Sirt2 G A 7: 28,787,766 V318M probably damaging Het
Slc1a2 T A 2: 102,737,852 I78K probably damaging Het
Slco3a1 A G 7: 74,359,829 I246T probably benign Het
Smpd5 A G 15: 76,295,726 E325G probably benign Het
Snw1 T C 12: 87,453,903 E362G probably benign Het
Tmem63c A T 12: 87,061,554 M114L possibly damaging Het
Trim24 T C 6: 37,871,307 L66P probably damaging Het
Trpm3 T C 19: 22,918,696 F966L possibly damaging Het
Ttn T C 2: 76,779,299 I17588V probably benign Het
Vmn2r44 A T 7: 8,368,228 C606* probably null Het
Vmn2r74 A T 7: 85,952,246 V728E probably benign Het
Zfp503 T C 14: 21,985,951 D299G possibly damaging Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 splice site probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
R7170:Gne UTSW 4 44040361 missense possibly damaging 0.95
R7191:Gne UTSW 4 44040266 missense probably benign 0.16
R7264:Gne UTSW 4 44042175 missense probably damaging 0.96
R7413:Gne UTSW 4 44044857 missense probably benign 0.06
R7956:Gne UTSW 4 44044962 missense probably benign 0.32
R8734:Gne UTSW 4 44072911 unclassified probably benign
RF012:Gne UTSW 4 44060045 missense probably damaging 1.00
RF014:Gne UTSW 4 44060045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACATCGAGGCTACCCAAAG -3'
(R):5'- GGAAGAATTCGGAGCCACTC -3'

Sequencing Primer
(F):5'- GGCTACCCAAAGCTGTACAGTG -3'
(R):5'- CTCCCTCCCTTTCAAAGAGGCG -3'
Posted On2020-07-13