Incidental Mutation 'R8249:Agbl2'
ID640312
Institutional Source Beutler Lab
Gene Symbol Agbl2
Ensembl Gene ENSMUSG00000040812
Gene NameATP/GTP binding protein-like 2
SynonymsA430081C19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8249 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90782727-90834437 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90797564 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 238 (G238R)
Ref Sequence ENSEMBL: ENSMUSP00000048647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037206] [ENSMUST00000037219] [ENSMUST00000051831] [ENSMUST00000111481] [ENSMUST00000136058] [ENSMUST00000170320]
Predicted Effect probably damaging
Transcript: ENSMUST00000037206
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047936
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 375 541 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037219
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048647
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051831
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051620
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 565 1.6e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111481
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107106
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136058
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115632
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 2.8e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170320
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129216
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 558 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,321,812 S441P probably benign Het
Adck2 C T 6: 39,585,733 R513* probably null Het
Apoa1bp A T 3: 88,058,388 W35R possibly damaging Het
Arhgap12 A T 18: 6,027,635 I736N probably damaging Het
AW554918 C T 18: 25,339,718 T193I probably benign Het
Bscl2 T C 19: 8,846,520 Y270H probably damaging Het
Btd T C 14: 31,665,948 Y112H probably damaging Het
Camk2d C T 3: 126,797,729 H283Y probably damaging Het
Cnga1 T C 5: 72,605,394 Y259C probably benign Het
Dnm3 A T 1: 162,477,743 C27* probably null Het
Fam126b G A 1: 58,534,637 S336L probably benign Het
Fbxo48 T A 11: 16,953,433 S20T possibly damaging Het
Fkbp6 A G 5: 135,349,952 S14P possibly damaging Het
Gcfc2 T C 6: 81,956,951 F730L probably benign Het
Gm136 C A 4: 34,750,955 R106L probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Grin2c C T 11: 115,253,837 R621Q probably damaging Het
H2-M11 T A 17: 36,549,008 W298R probably damaging Het
Hars2 A T 18: 36,788,001 I209F probably damaging Het
Hmcn1 A T 1: 150,819,366 N262K probably benign Het
Ifit1 T A 19: 34,640,989 probably null Het
Ighv1-85 T C 12: 116,000,224 D52G probably benign Het
Kit T C 5: 75,641,408 V657A probably damaging Het
Krt32 T C 11: 100,086,722 I173V probably benign Het
Lrfn3 GC GCCAGGGGAGGTGAGCGGTGGGTCACCTCCC 7: 30,359,873 probably null Het
Lrp1 C A 10: 127,605,543 S237I probably benign Het
Map3k9 T C 12: 81,780,777 D33G unknown Het
Mroh7 T C 4: 106,721,212 T90A probably benign Het
Mterf1a A C 5: 3,891,550 I106S probably damaging Het
Mtrf1 C A 14: 79,401,479 A17E probably benign Het
Musk T G 4: 58,368,926 L635R probably damaging Het
Nlrp9c T A 7: 26,375,353 K806* probably null Het
Pi4k2a A G 19: 42,115,062 E337G probably benign Het
Pwwp2b G T 7: 139,254,843 G67C probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Scn10a T A 9: 119,617,774 Y1396F probably damaging Het
Sdk1 A T 5: 142,188,015 probably null Het
Serpina1f C T 12: 103,693,768 G85E probably damaging Het
Tceanc2 G A 4: 107,178,993 probably benign Het
Tmem156 T A 5: 65,075,626 R186* probably null Het
Trbv16 A G 6: 41,151,998 T39A possibly damaging Het
Tti1 C G 2: 158,000,715 S798T probably benign Het
Unc80 A T 1: 66,619,491 M1656L probably benign Het
Wnt2 C A 6: 18,030,285 M1I probably null Het
Other mutations in Agbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Agbl2 APN 2 90801045 missense probably damaging 1.00
IGL00515:Agbl2 APN 2 90793960 missense possibly damaging 0.93
IGL01694:Agbl2 APN 2 90801074 missense probably damaging 1.00
IGL02064:Agbl2 APN 2 90784024 utr 5 prime probably benign
IGL02708:Agbl2 APN 2 90801342 missense probably benign 0.23
IGL02715:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02717:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02982:Agbl2 APN 2 90805815 missense probably damaging 1.00
IGL03039:Agbl2 APN 2 90801222 missense possibly damaging 0.93
IGL03339:Agbl2 APN 2 90797563 missense probably damaging 1.00
R0243:Agbl2 UTSW 2 90791481 missense possibly damaging 0.80
R0381:Agbl2 UTSW 2 90784098 missense probably damaging 1.00
R0441:Agbl2 UTSW 2 90797483 nonsense probably null
R0549:Agbl2 UTSW 2 90789843 splice site probably benign
R0665:Agbl2 UTSW 2 90801210 missense probably damaging 1.00
R1412:Agbl2 UTSW 2 90788954 missense probably benign
R1682:Agbl2 UTSW 2 90784090 missense probably benign 0.06
R1694:Agbl2 UTSW 2 90801320 missense probably damaging 1.00
R1733:Agbl2 UTSW 2 90810745 missense probably damaging 1.00
R1750:Agbl2 UTSW 2 90816376 utr 3 prime probably benign
R1916:Agbl2 UTSW 2 90815441 missense possibly damaging 0.73
R1940:Agbl2 UTSW 2 90811282 missense probably damaging 0.99
R3115:Agbl2 UTSW 2 90805901 missense possibly damaging 0.85
R3407:Agbl2 UTSW 2 90791618 missense probably damaging 1.00
R3710:Agbl2 UTSW 2 90805808 missense probably benign 0.00
R4227:Agbl2 UTSW 2 90801453 missense probably damaging 0.96
R4719:Agbl2 UTSW 2 90815389 missense probably benign 0.01
R4903:Agbl2 UTSW 2 90797473 missense possibly damaging 0.50
R5170:Agbl2 UTSW 2 90803197 missense probably benign 0.10
R5535:Agbl2 UTSW 2 90810006 missense probably benign 0.26
R5677:Agbl2 UTSW 2 90807978 missense possibly damaging 0.66
R6041:Agbl2 UTSW 2 90808027 missense probably benign 0.00
R6195:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6233:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6607:Agbl2 UTSW 2 90801326 missense probably damaging 0.99
R6752:Agbl2 UTSW 2 90803074 missense probably damaging 1.00
R7104:Agbl2 UTSW 2 90797547 missense probably damaging 1.00
R7261:Agbl2 UTSW 2 90788944 missense possibly damaging 0.94
R7555:Agbl2 UTSW 2 90791555 missense probably damaging 1.00
R7704:Agbl2 UTSW 2 90789005 missense probably benign 0.05
R7833:Agbl2 UTSW 2 90815433 missense probably benign 0.00
R7960:Agbl2 UTSW 2 90791631 missense probably benign 0.01
R8070:Agbl2 UTSW 2 90791565 missense probably benign 0.00
R8248:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8250:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8501:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAGCATTAGCCTCATGG -3'
(R):5'- CGGATCCAACTTTTAAGTGATCTC -3'

Sequencing Primer
(F):5'- GGAGCATTAGCCTCATGGTATCTTTC -3'
(R):5'- CACCCATCTTTTGCAGACA -3'
Posted On2020-07-28