Incidental Mutation 'R8307:Tsks'
ID641130
Institutional Source Beutler Lab
Gene Symbol Tsks
Ensembl Gene ENSMUSG00000059891
Gene Nametestis-specific serine kinase substrate
SynonymsTssks1, Stk22s1, Tsks, clone 4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8307 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44943204-44958035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44957662 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 140 (G140S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063761] [ENSMUST00000080233] [ENSMUST00000120929] [ENSMUST00000212836]
Predicted Effect probably benign
Transcript: ENSMUST00000063761
SMART Domains Protein: ENSMUSP00000069539
Gene: ENSMUSG00000007783

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-21 PFAM
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 757 7.7e-167 PFAM
Predicted Effect silent
Transcript: ENSMUST00000080233
SMART Domains Protein: ENSMUSP00000079122
Gene: ENSMUSG00000059891

DomainStartEndE-ValueType
Pfam:TSKS 26 525 5.7e-281 PFAM
Predicted Effect silent
Transcript: ENSMUST00000120929
SMART Domains Protein: ENSMUSP00000112673
Gene: ENSMUSG00000059891

DomainStartEndE-ValueType
Pfam:TSKS 26 585 8.1e-297 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212836
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of a small family of testis-specific serine/threonine kinases. This gene may play a role in testicular physiology or spermiogenesis. Its expression is restricted to the testis during the last stages of spermatid maturation. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C A 4: 147,941,380 T119K probably benign Het
Abca13 T A 11: 9,277,922 L655* probably null Het
Aifm2 A G 10: 61,726,392 Y69C probably damaging Het
Atp2c1 C T 9: 105,442,831 V448I probably benign Het
Barx2 A G 9: 31,859,011 S74P probably damaging Het
Bod1l T C 5: 41,821,155 K939E probably damaging Het
Cdh12 C A 15: 21,358,863 F124L probably benign Het
Cdh12 T A 15: 21,358,864 Y125N probably damaging Het
Cdx2 A G 5: 147,306,667 Y106H possibly damaging Het
Chmp1a C T 8: 123,206,241 G158S probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cntnap1 A T 11: 101,188,876 Y1277F possibly damaging Het
Dennd4c A C 4: 86,825,872 D1317A probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock2 A T 11: 34,310,362 M993K possibly damaging Het
Dpy19l1 G A 9: 24,503,001 P44S probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Epg5 T A 18: 78,022,679 F2078Y probably damaging Het
Fam208a G T 14: 27,471,665 A941S probably damaging Het
Fbn1 C A 2: 125,505,482 R41L possibly damaging Het
Gemin5 G A 11: 58,151,594 T467M probably damaging Het
Gm11744 A T 11: 116,659,373 T76S possibly damaging Het
Gm6205 T G 5: 94,683,557 L141R probably damaging Het
Hexb T C 13: 97,194,199 Q102R probably benign Het
Hmcn2 A G 2: 31,396,115 D2093G probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Igkv1-131 A G 6: 67,766,067 Y111H probably damaging Het
Il6st G T 13: 112,487,747 G177V probably benign Het
Kank4 G A 4: 98,778,678 Q511* probably null Het
Krt90 A G 15: 101,559,199 L248P probably damaging Het
Krtap5-2 A G 7: 142,174,849 C187R unknown Het
Lonp1 C A 17: 56,626,573 A101S probably benign Het
Nckap5l A G 15: 99,423,177 C1241R probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr339 A G 2: 36,422,321 T308A probably benign Het
Olfr772 T C 10: 129,174,232 D263G probably benign Het
Pcdh15 T A 10: 74,506,475 C1131* probably null Het
Pcdhgc3 A G 18: 37,807,794 D416G probably damaging Het
Pikfyve T C 1: 65,245,735 M786T possibly damaging Het
Pink1 A T 4: 138,317,962 M297K probably benign Het
Pln T C 10: 53,343,879 Y6H unknown Het
Ppp2r2c A G 5: 36,947,086 D270G probably damaging Het
Pxylp1 A G 9: 96,839,084 probably null Het
Rab11fip4 A T 11: 79,690,774 N532Y possibly damaging Het
Ralgapa1 C A 12: 55,741,523 V592L probably damaging Het
Robo2 T C 16: 73,956,610 D793G probably damaging Het
Sec14l1 G A 11: 117,143,416 probably null Het
Srcap T A 7: 127,525,369 V237E probably damaging Het
Srl A G 16: 4,497,145 I211T probably benign Het
Tet3 A G 6: 83,379,927 V883A probably damaging Het
Trim46 A G 3: 89,243,916 Y113H probably benign Het
Trim58 G A 11: 58,647,083 A267T probably benign Het
Vmn2r110 C A 17: 20,583,057 V419L probably benign Het
Vmn2r66 A G 7: 85,007,062 F249L probably benign Het
Vps8 A C 16: 21,495,902 D584A probably benign Het
Zfp605 T A 5: 110,128,197 C394S probably damaging Het
Zscan4e A G 7: 11,307,132 I271T probably benign Het
Other mutations in Tsks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Tsks APN 7 44952558 missense probably damaging 1.00
IGL03006:Tsks APN 7 44950774 unclassified probably benign
IGL03065:Tsks APN 7 44943300 missense probably damaging 1.00
IGL03091:Tsks APN 7 44957895 missense possibly damaging 0.54
R0139:Tsks UTSW 7 44954459 missense probably benign
R0619:Tsks UTSW 7 44950834 missense probably damaging 1.00
R3709:Tsks UTSW 7 44951885 missense possibly damaging 0.62
R4273:Tsks UTSW 7 44957929 missense probably damaging 1.00
R4982:Tsks UTSW 7 44943994 missense possibly damaging 0.69
R5664:Tsks UTSW 7 44953784 missense probably damaging 1.00
R5846:Tsks UTSW 7 44943988 missense probably damaging 1.00
R6193:Tsks UTSW 7 44953839 missense probably damaging 0.96
R6567:Tsks UTSW 7 44953881 missense probably damaging 1.00
R7044:Tsks UTSW 7 44943792 missense probably damaging 0.99
R7255:Tsks UTSW 7 44952688 missense probably benign 0.13
R7845:Tsks UTSW 7 44953744 splice site probably null
R8073:Tsks UTSW 7 44957881 missense probably benign
R8162:Tsks UTSW 7 44953872 missense probably damaging 1.00
R8340:Tsks UTSW 7 44952720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCTGACGGGTTACTTTG -3'
(R):5'- CACCTTCTCCCTGCAATGACAG -3'

Sequencing Primer
(F):5'- GGGTGGTATGCGGGCTCC -3'
(R):5'- CCAGCTGGGGATCAGTACTGTG -3'
Posted On2020-07-28