Incidental Mutation 'R8372:Bcl9l'
ID646496
Institutional Source Beutler Lab
Gene Symbol Bcl9l
Ensembl Gene ENSMUSG00000063382
Gene NameB cell CLL/lymphoma 9-like
SynonymsDLNB11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8372 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44482825-44511896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44507231 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 826 (M826V)
Ref Sequence ENSEMBL: ENSMUSP00000074516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062215] [ENSMUST00000074989] [ENSMUST00000179828] [ENSMUST00000215293] [ENSMUST00000218183] [ENSMUST00000220303]
Predicted Effect probably benign
Transcript: ENSMUST00000062215
SMART Domains Protein: ENSMUSP00000050444
Gene: ENSMUSG00000047880

DomainStartEndE-ValueType
Pfam:7tm_1 70 324 8.9e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074989
AA Change: M826V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074516
Gene: ENSMUSG00000063382
AA Change: M826V

DomainStartEndE-ValueType
low complexity region 215 234 N/A INTRINSIC
PDB:2XB1|C 236 269 2e-14 PDB
low complexity region 278 292 N/A INTRINSIC
low complexity region 297 325 N/A INTRINSIC
low complexity region 337 376 N/A INTRINSIC
Pfam:BCL9 395 432 2.4e-18 PFAM
low complexity region 490 507 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 590 602 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179828
SMART Domains Protein: ENSMUSP00000137518
Gene: ENSMUSG00000047880

DomainStartEndE-ValueType
Pfam:7tm_1 70 324 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215293
Predicted Effect probably benign
Transcript: ENSMUST00000218183
AA Change: M826V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220303
AA Change: M789V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,288 D155G probably damaging Het
Adgrg7 T A 16: 56,795,751 probably benign Het
Agap2 T C 10: 127,089,316 S833P unknown Het
B4galnt2 T C 11: 95,869,280 E307G possibly damaging Het
C2cd3 C T 7: 100,455,280 Q2167* probably null Het
Ccdc7a T C 8: 128,821,104 E1289G possibly damaging Het
Cep290 T C 10: 100,549,341 V1893A probably benign Het
Clec4g T C 8: 3,707,990 probably benign Het
Cspg4 A G 9: 56,887,195 E738G probably damaging Het
Cyth4 A G 15: 78,597,135 probably benign Het
Dab2 A C 15: 6,416,925 S8R possibly damaging Het
Dclk3 A G 9: 111,485,013 D719G probably damaging Het
Dync2h1 A G 9: 7,111,514 V2540A possibly damaging Het
Elavl1 T C 8: 4,289,664 N306S probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Fcgr2b A G 1: 170,965,761 V233A probably benign Het
Gfm2 T C 13: 97,165,044 S452P possibly damaging Het
Gm10229 G C 16: 89,015,497 G57R unknown Het
Gpr15 A G 16: 58,718,487 F80L probably benign Het
Ighv13-2 A T 12: 114,358,061 C19* probably null Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Klhl33 C T 14: 50,892,232 R312Q probably damaging Het
Klhl9 A G 4: 88,721,359 L215P probably damaging Het
Olfr826 A G 10: 130,180,787 F31S probably damaging Het
Parp8 T A 13: 116,855,250 Q872H probably damaging Het
Plxnb2 A G 15: 89,158,493 S1531P probably damaging Het
Psg16 A G 7: 17,095,315 T275A probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Rapgef1 G A 2: 29,710,231 G655S probably damaging Het
Rbm15b T C 9: 106,885,563 M19V Het
Rbm42 A G 7: 30,641,206 S447P unknown Het
Rsf1 T C 7: 97,662,417 S785P Het
Scnn1a A G 6: 125,343,718 N578S probably damaging Het
Slc39a7 T C 17: 34,030,665 N169D probably damaging Het
Spp1 A G 5: 104,440,256 T175A probably benign Het
Tigd5 A G 15: 75,910,488 H233R probably benign Het
Tmprss3 C T 17: 31,184,697 V377I probably benign Het
Vmn1r75 A T 7: 11,880,730 I130F probably benign Het
Xpo4 A G 14: 57,597,884 probably null Het
Xrn1 A G 9: 96,024,113 T1186A probably benign Het
Zcchc4 T C 5: 52,796,164 Y172H probably damaging Het
Other mutations in Bcl9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Bcl9l APN 9 44505627 missense possibly damaging 0.86
IGL00969:Bcl9l APN 9 44508242 missense possibly damaging 0.79
IGL01011:Bcl9l APN 9 44505179 missense possibly damaging 0.85
IGL01396:Bcl9l APN 9 44506824 missense probably damaging 0.99
IGL02015:Bcl9l APN 9 44508801 splice site probably null
IGL02106:Bcl9l APN 9 44509199 missense probably benign 0.03
IGL02310:Bcl9l APN 9 44509305 missense probably damaging 1.00
IGL02447:Bcl9l APN 9 44507334 missense probably benign 0.09
IGL02534:Bcl9l APN 9 44505739 missense probably benign 0.00
IGL02541:Bcl9l APN 9 44507769 missense probably benign 0.02
IGL02688:Bcl9l APN 9 44505263 missense possibly damaging 0.86
IGL02931:Bcl9l APN 9 44500750 missense probably damaging 0.96
R0098:Bcl9l UTSW 9 44505617 missense probably benign
R0142:Bcl9l UTSW 9 44507112 missense probably benign 0.09
R0193:Bcl9l UTSW 9 44507406 missense probably damaging 1.00
R0227:Bcl9l UTSW 9 44505236 missense possibly damaging 0.96
R0481:Bcl9l UTSW 9 44506682 missense probably benign
R0496:Bcl9l UTSW 9 44509518 missense probably benign 0.00
R1741:Bcl9l UTSW 9 44509689 missense probably damaging 0.99
R1971:Bcl9l UTSW 9 44508699 splice site probably null
R1976:Bcl9l UTSW 9 44506152 missense possibly damaging 0.76
R4415:Bcl9l UTSW 9 44501879 missense possibly damaging 0.83
R4751:Bcl9l UTSW 9 44506803 missense probably damaging 0.99
R4810:Bcl9l UTSW 9 44508353 missense probably damaging 1.00
R4880:Bcl9l UTSW 9 44508710 missense probably benign 0.01
R4967:Bcl9l UTSW 9 44505068 missense possibly damaging 0.85
R5418:Bcl9l UTSW 9 44505436 missense possibly damaging 0.53
R5572:Bcl9l UTSW 9 44500798 missense possibly damaging 0.66
R5658:Bcl9l UTSW 9 44509169 missense probably damaging 1.00
R5812:Bcl9l UTSW 9 44506644 missense probably benign 0.01
R6515:Bcl9l UTSW 9 44507874 splice site probably null
R6670:Bcl9l UTSW 9 44507072 small insertion probably benign
R6682:Bcl9l UTSW 9 44501103 missense possibly damaging 0.91
R6966:Bcl9l UTSW 9 44509388 nonsense probably null
R7171:Bcl9l UTSW 9 44505151 missense probably benign 0.33
R7338:Bcl9l UTSW 9 44508708 missense probably benign
R7448:Bcl9l UTSW 9 44509337 missense probably benign 0.00
R7609:Bcl9l UTSW 9 44505747 missense probably damaging 0.99
R7793:Bcl9l UTSW 9 44508966 missense probably benign 0.00
R7793:Bcl9l UTSW 9 44509697 missense probably damaging 0.97
R8491:Bcl9l UTSW 9 44500768 missense probably benign 0.02
R8769:Bcl9l UTSW 9 44508966 missense probably benign 0.01
R8945:Bcl9l UTSW 9 44500941 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACCCATGGGCATAGAGTTTGG -3'
(R):5'- GATGGTGAGATCTGAAGGCC -3'

Sequencing Primer
(F):5'- TCCTGAGCCCTCCAATGG -3'
(R):5'- TGTTGGAGGCCAAGTGCAC -3'
Posted On2020-09-02