Incidental Mutation 'R8375:Rtn4rl2'
ID646609
Institutional Source Beutler Lab
Gene Symbol Rtn4rl2
Ensembl Gene ENSMUSG00000050896
Gene Namereticulon 4 receptor-like 2
SynonymsNgrl3, Ngr2, Ngrh1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R8375 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location84871924-84886710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84880689 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 77 (L77H)
Ref Sequence ENSEMBL: ENSMUSP00000118362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054514] [ENSMUST00000151799]
Predicted Effect probably damaging
Transcript: ENSMUST00000054514
AA Change: L71H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057725
Gene: ENSMUSG00000050896
AA Change: L71H

DomainStartEndE-ValueType
LRRNT 30 64 1.45e-1 SMART
LRR 63 82 2.47e1 SMART
LRR 83 104 6.58e0 SMART
LRR 105 129 2.32e-1 SMART
LRR_TYP 130 153 2.4e-3 SMART
LRR_TYP 154 177 2.71e-2 SMART
LRR_TYP 178 201 1.36e-2 SMART
LRR_TYP 202 225 4.72e-2 SMART
LRR 226 249 1.25e-1 SMART
LRRCT 261 311 3.1e-7 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151799
AA Change: L77H

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118362
Gene: ENSMUSG00000050896
AA Change: L77H

DomainStartEndE-ValueType
LRRNT 36 70 1.45e-1 SMART
LRR 69 88 2.47e1 SMART
LRR 89 110 6.58e0 SMART
LRR 111 135 2.32e-1 SMART
LRR_TYP 136 159 2.4e-3 SMART
LRR_TYP 160 183 2.71e-2 SMART
LRR_TYP 184 207 1.36e-2 SMART
LRR_TYP 208 231 4.72e-2 SMART
LRR 232 255 1.25e-1 SMART
LRRCT 267 317 3.1e-7 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,315,416 F3030L probably benign Het
Abca13 A T 11: 9,397,841 I3565F probably damaging Het
Ak7 A T 12: 105,742,341 I352F probably damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Anapc7 C T 5: 122,428,279 P84S probably benign Het
Apol7a A T 15: 77,389,347 I305N probably damaging Het
Asf1b C T 8: 83,967,930 R108C probably damaging Het
Bicd1 A T 6: 149,520,491 E903D probably benign Het
Bpifb3 A T 2: 153,925,795 I263F probably benign Het
Cavin3 T A 7: 105,481,021 S195C probably damaging Het
Chsy3 C A 18: 59,179,513 R353S probably damaging Het
Col5a2 A G 1: 45,442,730 V78A unknown Het
Cpxm1 C T 2: 130,394,226 E339K probably damaging Het
Cyp26c1 G T 19: 37,687,212 A175S probably benign Het
Dnah5 A T 15: 28,327,343 T2069S probably benign Het
Ednrb A G 14: 103,819,947 F393S probably damaging Het
Fstl4 T C 11: 53,162,675 S385P possibly damaging Het
Gabpb2 G A 3: 95,204,798 S40L probably damaging Het
Gabrb1 T C 5: 72,029,829 I155T probably damaging Het
Hc T A 2: 34,983,719 N1668Y probably benign Het
Kcnh1 A G 1: 192,434,816 H670R probably damaging Het
Krt31 G A 11: 100,047,777 A330V probably benign Het
Lrfn2 T A 17: 49,096,823 M658K possibly damaging Het
Lrrc1 T A 9: 77,457,847 N184I probably damaging Het
Lrrc69 T C 4: 14,795,994 I18V probably benign Het
Lvrn G A 18: 46,850,222 V11M probably damaging Het
Map4k4 T C 1: 40,024,641 S1199P possibly damaging Het
Mib1 T C 18: 10,768,233 probably null Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Myo18b C T 5: 112,760,393 V2005I possibly damaging Het
Myo6 T A 9: 80,254,924 H314Q unknown Het
Nat8f6 A C 6: 85,808,906 M87R probably benign Het
Net1 A G 13: 3,893,458 probably benign Het
Notch4 C T 17: 34,568,254 T294I possibly damaging Het
Nrros A G 16: 32,147,638 L36P probably damaging Het
Olfr25 G C 9: 38,329,935 W113S probably benign Het
Olfr870 T C 9: 20,170,741 M277V probably benign Het
Padi3 T C 4: 140,798,096 H202R probably damaging Het
Pik3ap1 A T 19: 41,328,099 M284K probably damaging Het
Prr27 C A 5: 87,842,851 Y107* probably null Het
Rab5c G T 11: 100,716,783 N188K probably damaging Het
Rlf A T 4: 121,148,335 S1259R probably damaging Het
Rrm2 T C 12: 24,712,752 V298A probably damaging Het
Skint4 A G 4: 112,117,976 I44M probably damaging Het
Spaca7 T C 8: 12,598,998 I164T probably benign Het
Spg7 A G 8: 123,073,829 S153G probably damaging Het
Spink5 T C 18: 43,990,719 S358P probably benign Het
Stx5a T C 19: 8,755,098 M377T unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Ttc41 A G 10: 86,763,980 D1048G probably damaging Het
Ttn A T 2: 76,727,165 W29862R probably damaging Het
Vmn1r203 T G 13: 22,524,984 *312G probably null Het
Vmn2r74 T G 7: 85,952,706 T575P possibly damaging Het
Zfp14 A T 7: 30,039,154 N135K possibly damaging Het
Other mutations in Rtn4rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0626:Rtn4rl2 UTSW 2 84880419 missense probably damaging 0.99
R0837:Rtn4rl2 UTSW 2 84880692 missense probably damaging 1.00
R1392:Rtn4rl2 UTSW 2 84880512 missense probably damaging 1.00
R1392:Rtn4rl2 UTSW 2 84880512 missense probably damaging 1.00
R3433:Rtn4rl2 UTSW 2 84872100 missense probably damaging 1.00
R3857:Rtn4rl2 UTSW 2 84880386 critical splice donor site probably null
R3858:Rtn4rl2 UTSW 2 84880386 critical splice donor site probably null
R5044:Rtn4rl2 UTSW 2 84872502 missense probably damaging 1.00
R5936:Rtn4rl2 UTSW 2 84880431 missense probably damaging 1.00
R6800:Rtn4rl2 UTSW 2 84880623 missense probably damaging 1.00
R7755:Rtn4rl2 UTSW 2 84872463 missense possibly damaging 0.82
R8416:Rtn4rl2 UTSW 2 84872607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACAGGTGTAGTGACTGCAGC -3'
(R):5'- CACTATGCTCTCCCCACAGG -3'

Sequencing Primer
(F):5'- GTGTAGTGACTGCAGCCTCTC -3'
(R):5'- ACAGGTCCTGCCTCAGC -3'
Posted On2020-09-02