Incidental Mutation 'R8394:Hspa14'
ID647513
Institutional Source Beutler Lab
Gene Symbol Hspa14
Ensembl Gene ENSMUSG00000109865
Gene Nameheat shock protein 14
SynonymsHsp70-4, 70kDa, NST-1, HSP70L1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R8394 (G1)
Quality Score169.009
Status Not validated
Chromosome2
Chromosomal Location3488850-3512814 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 3512633 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027961] [ENSMUST00000036350] [ENSMUST00000124331] [ENSMUST00000140494]
Predicted Effect probably null
Transcript: ENSMUST00000027961
SMART Domains Protein: ENSMUSP00000027961
Gene: ENSMUSG00000109865

DomainStartEndE-ValueType
Pfam:HSP70 3 509 6.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036350
SMART Domains Protein: ENSMUSP00000046297
Gene: ENSMUSG00000039496

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Armet 36 181 2.6e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124331
SMART Domains Protein: ENSMUSP00000119850
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 74 1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140494
SMART Domains Protein: ENSMUSP00000120385
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 88 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T C 14: 59,142,174 N137S probably benign Het
4930505A04Rik T A 11: 30,454,880 probably null Het
Abcc8 A G 7: 46,154,553 I399T probably benign Het
Aldh3b2 A C 19: 3,979,461 Q278P probably benign Het
Arl8b A G 6: 108,783,283 D10G possibly damaging Het
Baiap3 T C 17: 25,250,122 N229S probably benign Het
Chrdl2 T C 7: 100,017,085 S71P possibly damaging Het
Cmbl A G 15: 31,585,395 M142V possibly damaging Het
Cpt1b A G 15: 89,422,287 probably null Het
Crybg3 T C 16: 59,558,288 K868E probably benign Het
Efl1 A G 7: 82,762,778 I792V probably benign Het
Evx2 A G 2: 74,655,977 L356S probably benign Het
Ighv5-8 C T 12: 113,655,193 A76V unknown Het
Il7r A G 15: 9,516,418 F99S probably damaging Het
Klra2 A T 6: 131,245,310 V6D possibly damaging Het
Lce3c T C 3: 92,945,453 S74P unknown Het
Nectin2 C T 7: 19,733,212 probably null Het
Nfil3 A G 13: 52,967,813 S352P probably benign Het
Nme6 T A 9: 109,835,326 M1K probably null Het
Olfr618 A T 7: 103,598,197 I294F probably damaging Het
Otogl A G 10: 107,886,465 probably null Het
Plcb1 T C 2: 135,317,790 V391A probably damaging Het
Ptf1a T A 2: 19,445,935 D25E probably damaging Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Scube1 T C 15: 83,608,291 Y944C probably damaging Het
Sdk2 A G 11: 113,838,716 I1039T probably benign Het
Senp7 G T 16: 56,169,827 W646L possibly damaging Het
Sphkap A T 1: 83,276,076 N1317K probably benign Het
Strc G T 2: 121,379,009 Q278K probably benign Het
Tbc1d30 T A 10: 121,347,108 R142* probably null Het
Tmtc3 T C 10: 100,446,946 I916V probably damaging Het
Tomm40l A T 1: 171,221,207 H79Q probably damaging Het
Txndc12 T A 4: 108,856,223 probably null Het
Vmn2r2 T C 3: 64,137,437 N96S probably damaging Het
Vmn2r27 T C 6: 124,191,817 T785A possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp462 A G 4: 55,011,862 D1276G probably damaging Het
Other mutations in Hspa14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Hspa14 APN 2 3502759 missense probably damaging 1.00
IGL02293:Hspa14 APN 2 3511034 missense probably damaging 1.00
IGL02477:Hspa14 APN 2 3496624 missense probably damaging 0.98
IGL02711:Hspa14 APN 2 3502520 missense probably benign 0.15
R0522:Hspa14 UTSW 2 3511049 missense probably damaging 1.00
R1169:Hspa14 UTSW 2 3498124 missense possibly damaging 0.90
R1426:Hspa14 UTSW 2 3508821 missense probably damaging 1.00
R1471:Hspa14 UTSW 2 3491608 missense probably benign 0.01
R1846:Hspa14 UTSW 2 3491660 missense possibly damaging 0.50
R1971:Hspa14 UTSW 2 3489767 missense possibly damaging 0.51
R2353:Hspa14 UTSW 2 3511176 splice site probably null
R3508:Hspa14 UTSW 2 3491008 missense probably damaging 1.00
R3859:Hspa14 UTSW 2 3494579 nonsense probably null
R4012:Hspa14 UTSW 2 3512638 missense probably damaging 0.99
R4360:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R4938:Hspa14 UTSW 2 3491609 missense probably benign 0.01
R5028:Hspa14 UTSW 2 3498169 missense possibly damaging 0.72
R5326:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5542:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5881:Hspa14 UTSW 2 3498170 missense probably benign 0.34
R6046:Hspa14 UTSW 2 3489764 missense possibly damaging 0.91
R6076:Hspa14 UTSW 2 3511072 missense probably benign 0.00
R6112:Hspa14 UTSW 2 3498068 missense probably benign
R6334:Hspa14 UTSW 2 3489072 splice site probably null
R7297:Hspa14 UTSW 2 3498142 missense possibly damaging 0.76
R7424:Hspa14 UTSW 2 3489041 missense possibly damaging 0.95
R7510:Hspa14 UTSW 2 3498122 missense probably benign 0.01
R7692:Hspa14 UTSW 2 3496606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTATCCAAGATCCGGCTC -3'
(R):5'- CCTTATGTTGATTGGCTGCGAC -3'

Sequencing Primer
(F):5'- AAGATCCGGCTCTCTGTATCCAC -3'
(R):5'- ATTGGCTGCGACTTGGGAG -3'
Posted On2020-09-02