Incidental Mutation 'R7919:Gm19965'
ID648210
Institutional Source Beutler Lab
Gene Symbol Gm19965
Ensembl Gene ENSMUSG00000094429
Gene Namepredicted gene, 19965
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7919 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location116802983-116823410 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 116822120 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 510 (C510*)
Ref Sequence ENSEMBL: ENSMUSP00000137019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179777]
Predicted Effect probably null
Transcript: ENSMUST00000179777
AA Change: C510*
SMART Domains Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429
AA Change: C510*

DomainStartEndE-ValueType
KRAB 8 68 1.5e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T G 3: 138,179,550 K95T probably damaging Het
9430097D07Rik T C 2: 32,574,449 T113A unknown Het
Abcc2 T C 19: 43,816,809 Y701H probably damaging Het
Adcy2 T A 13: 68,887,972 H190L probably benign Het
Arhgef15 T C 11: 68,947,605 T623A probably benign Het
Armc3 A G 2: 19,286,095 T462A probably benign Het
Calhm2 C T 19: 47,133,008 V241M possibly damaging Het
Cdc25c T C 18: 34,735,376 I314V probably damaging Het
Cntrl G A 2: 35,127,401 D407N probably benign Het
Dnah5 A G 15: 28,350,596 E2588G probably damaging Het
Dnm1 T A 2: 32,339,978 N178Y probably damaging Het
Eaf2 T A 16: 36,810,552 E86D probably damaging Het
Elf1 C A 14: 79,560,899 D75E probably benign Het
Fem1c T C 18: 46,524,303 T115A probably damaging Het
Garnl3 A G 2: 33,046,599 V186A probably benign Het
Gatb T A 3: 85,604,521 S194R probably damaging Het
Gm10775 T A 13: 65,260,099 N71K unknown Het
Hydin A G 8: 110,267,339 T2A unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Jag1 G A 2: 137,088,446 T726M probably damaging Het
Kank1 A G 19: 25,431,075 D1306G probably damaging Het
Krt26 T A 11: 99,333,594 E366V probably damaging Het
Ksr2 A G 5: 117,761,353 E872G possibly damaging Het
Med6 G A 12: 81,573,847 R242* probably null Het
Meis2 A G 2: 115,867,307 V370A probably benign Het
Mta2 C T 19: 8,949,134 R480* probably null Het
Mup3 A T 4: 62,084,592 N177K probably damaging Het
Myo15 T A 11: 60,526,530 V3435E probably damaging Het
Ncapg A G 5: 45,696,048 T880A probably benign Het
Obox1 A T 7: 15,556,331 K200* probably null Het
Olfr1045 A T 2: 86,198,265 C162* probably null Het
Ovgp1 T A 3: 105,981,285 V319D probably damaging Het
Plxdc2 A T 2: 16,548,225 I145F probably damaging Het
Prr30 T C 14: 101,199,111 N5S possibly damaging Het
Ptcd3 T C 6: 71,903,454 Y95C probably damaging Het
Rsl1d1 A G 16: 11,202,433 S44P probably benign Het
Sh3gl2 A G 4: 85,355,358 E49G probably benign Het
Shroom1 A G 11: 53,463,393 T47A probably benign Het
Slc20a1 G A 2: 129,207,837 D340N probably benign Het
Stx1b A G 7: 127,807,335 S281P probably benign Het
Tg A T 15: 66,684,074 I872F possibly damaging Het
Ubqln3 C T 7: 104,141,192 A564T probably benign Het
Vsnl1 T C 12: 11,332,086 E98G possibly damaging Het
Vwf T C 6: 125,647,859 L1857P Het
Wars C T 12: 108,881,104 E125K probably benign Het
Wnt16 G A 6: 22,291,050 S159N probably benign Het
Zcchc14 A G 8: 121,604,173 F817S probably damaging Het
Zufsp A G 10: 33,949,112 S125P possibly damaging Het
Other mutations in Gm19965
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0993:Gm19965 UTSW 1 116821825 missense probably benign 0.04
R1016:Gm19965 UTSW 1 116821301 nonsense probably null
R1173:Gm19965 UTSW 1 116820820 splice site probably benign
R1175:Gm19965 UTSW 1 116820820 splice site probably benign
R1335:Gm19965 UTSW 1 116804619 missense possibly damaging 0.79
R1773:Gm19965 UTSW 1 116821259 nonsense probably null
R1802:Gm19965 UTSW 1 116820903 nonsense probably null
R2884:Gm19965 UTSW 1 116821583 missense probably benign 0.14
R3435:Gm19965 UTSW 1 116821623 missense possibly damaging 0.78
R4072:Gm19965 UTSW 1 116821071 missense probably benign 0.17
R4585:Gm19965 UTSW 1 116821778 missense probably benign 0.00
R4801:Gm19965 UTSW 1 116821896 missense probably benign
R4802:Gm19965 UTSW 1 116821896 missense probably benign
R5328:Gm19965 UTSW 1 116821418 missense possibly damaging 0.78
R5856:Gm19965 UTSW 1 116821849 missense probably benign
R5960:Gm19965 UTSW 1 116821471 missense possibly damaging 0.67
R6185:Gm19965 UTSW 1 116821273 missense possibly damaging 0.61
R6297:Gm19965 UTSW 1 116822680 missense possibly damaging 0.82
R6374:Gm19965 UTSW 1 116822291 missense probably benign 0.06
R6811:Gm19965 UTSW 1 116804079 missense probably damaging 1.00
R6860:Gm19965 UTSW 1 116820879 missense probably benign 0.19
R7076:Gm19965 UTSW 1 116821275 missense
R7162:Gm19965 UTSW 1 116822365 missense unknown
R7290:Gm19965 UTSW 1 116821191 missense
R7473:Gm19965 UTSW 1 116821872 missense unknown
R7643:Gm19965 UTSW 1 116822229 missense unknown
R8187:Gm19965 UTSW 1 116821802 nonsense probably null
R8306:Gm19965 UTSW 1 116821785 missense
R8477:Gm19965 UTSW 1 116803124 start gained probably benign
R8751:Gm19965 UTSW 1 116822137 missense unknown
R8876:Gm19965 UTSW 1 116822046 missense unknown
Z1088:Gm19965 UTSW 1 116804600 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TACAGGGATGCCTCAAATGAATC -3'
(R):5'- GAGGATCTTGTAAAAGATTTGCCAC -3'

Sequencing Primer
(F):5'- TTAAACTTTCAGAGAGACCAGAAAGC -3'
(R):5'- TGCCACATTCATTACATTTGTAAGG -3'
Posted On2020-09-15