Incidental Mutation 'R8350:Bcas1'
ID660202
Institutional Source Beutler Lab
Gene Symbol Bcas1
Ensembl Gene ENSMUSG00000013523
Gene Namebreast carcinoma amplified sequence 1
Synonyms9030223A09Rik, 2210416M21Rik, NABC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8350 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location170346991-170427845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 170406300 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 234 (N234D)
Ref Sequence ENSEMBL: ENSMUSP00000104780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013667] [ENSMUST00000068137] [ENSMUST00000109152]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013667
AA Change: N234D

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000013667
Gene: ENSMUSG00000013523
AA Change: N234D

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 391 398 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068137
AA Change: N224D

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069437
Gene: ENSMUSG00000013523
AA Change: N224D

DomainStartEndE-ValueType
low complexity region 164 177 N/A INTRINSIC
low complexity region 289 302 N/A INTRINSIC
low complexity region 335 342 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109152
AA Change: N234D

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104780
Gene: ENSMUSG00000013523
AA Change: N234D

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 312 N/A INTRINSIC
low complexity region 345 352 N/A INTRINSIC
low complexity region 496 508 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122298
Gene: ENSMUSG00000013523
AA Change: N70D

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G T 5: 8,928,578 probably null Het
Adam29 A G 8: 55,872,189 V410A possibly damaging Het
Adamts3 T C 5: 89,702,956 T575A probably damaging Het
Ankmy1 T C 1: 92,876,631 K877E possibly damaging Het
Arpin A T 7: 79,931,867 I35N possibly damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Clca2 C T 3: 145,077,907 G649E probably benign Het
Cnot2 A T 10: 116,486,276 L516Q probably damaging Het
Ctdp1 C A 18: 80,469,279 V90L probably benign Het
Cyb5b A G 8: 107,169,920 Y91C possibly damaging Het
Cystm1 T C 18: 36,393,250 probably benign Het
Dnhd1 C A 7: 105,678,024 Q727K probably damaging Het
Dpf3 G A 12: 83,350,851 R80C probably damaging Het
Ehmt2 C T 17: 34,908,691 T882M probably damaging Het
Fam136a A G 6: 86,368,813 K104R probably benign Het
Fcgbp T C 7: 28,094,189 V1172A probably benign Het
Foxc1 C T 13: 31,807,565 Q120* probably null Het
Gm5737 T C 7: 120,820,650 L206P probably damaging Het
Grin1 G A 2: 25,298,311 R448C probably damaging Het
Igsf10 G A 3: 59,331,528 P411S probably damaging Het
Irgq T A 7: 24,533,740 D335E probably benign Het
Kndc1 A G 7: 139,924,045 Y1088C probably damaging Het
Llgl1 A G 11: 60,712,121 E874G probably damaging Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Lyst T A 13: 13,650,388 C1529* probably null Het
Mau2 A T 8: 70,042,592 Y32N probably damaging Het
Mios T A 6: 8,227,998 N638K probably benign Het
Mki67 A T 7: 135,698,471 D1611E possibly damaging Het
Mroh2a G A 1: 88,244,083 probably null Het
Nek5 A G 8: 22,113,672 V138A probably damaging Het
Olfr107 A T 17: 37,406,369 M274L probably benign Het
Olfr29-ps1 T A 4: 43,782,175 I52F probably benign Het
Olfr342 T A 2: 36,528,164 Y251N probably damaging Het
Opcml A T 9: 28,902,167 E251D probably benign Het
Pde1b A T 15: 103,503,474 M1L probably benign Het
Pias1 G A 9: 62,951,984 H72Y probably damaging Het
Postn G A 3: 54,370,258 V225I probably damaging Het
Prickle2 A G 6: 92,376,502 V661A probably benign Het
Ptpn1 T A 2: 167,974,241 F225Y probably damaging Het
Ptprd C T 4: 75,950,661 V1425M probably damaging Het
Rbfox1 C A 16: 7,277,090 S111R probably benign Het
Rbm24 T C 13: 46,419,200 probably null Het
Rlf T G 4: 121,170,757 K224T probably damaging Het
Scgb2b3 G A 7: 31,362,060 L5F probably damaging Het
Serpinb9g A G 13: 33,492,871 E212G probably damaging Het
Sh3pxd2a T C 19: 47,268,707 Y524C probably damaging Het
Sh3pxd2a C A 19: 47,269,838 E475D probably null Het
Skil A G 3: 31,097,454 T42A probably benign Het
Sorcs2 A G 5: 36,153,863 V203A probably damaging Het
Sugp2 C T 8: 70,242,991 R205* probably null Het
Tle1 C A 4: 72,138,966 probably benign Het
Tmem63c T A 12: 87,072,886 L318Q probably damaging Het
Txnrd1 A G 10: 82,881,925 I248V probably benign Het
Vmn2r79 T A 7: 87,037,533 C707* probably null Het
Xdh C T 17: 73,934,842 G154D probably damaging Het
Xirp2 T A 2: 67,525,369 D3491E probably benign Het
Yjefn3 A G 8: 69,889,219 L77P probably damaging Het
Zer1 C T 2: 30,101,850 E653K probably damaging Het
Zfyve27 T C 19: 42,179,472 V151A probably benign Het
Zim1 T A 7: 6,682,065 S129C probably damaging Het
Other mutations in Bcas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Bcas1 APN 2 170349252 missense probably damaging 0.99
IGL01714:Bcas1 APN 2 170384182 splice site probably benign
IGL02267:Bcas1 APN 2 170378788 nonsense probably null
IGL02486:Bcas1 APN 2 170406398 missense probably damaging 1.00
IGL03328:Bcas1 APN 2 170366396 nonsense probably null
R0335:Bcas1 UTSW 2 170418681 missense probably damaging 0.97
R1458:Bcas1 UTSW 2 170387951 missense probably damaging 1.00
R1463:Bcas1 UTSW 2 170418664 missense probably benign 0.07
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1507:Bcas1 UTSW 2 170366428 missense probably damaging 0.99
R1645:Bcas1 UTSW 2 170387167 missense probably damaging 1.00
R1654:Bcas1 UTSW 2 170349246 missense probably damaging 1.00
R1911:Bcas1 UTSW 2 170387943 missense probably damaging 1.00
R1990:Bcas1 UTSW 2 170370477 missense possibly damaging 0.83
R2017:Bcas1 UTSW 2 170348161 splice site probably null
R4119:Bcas1 UTSW 2 170378815 missense probably benign 0.02
R4181:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4302:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4497:Bcas1 UTSW 2 170406821 missense probably damaging 1.00
R4670:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4671:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4914:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4915:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4917:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4918:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R5155:Bcas1 UTSW 2 170418618 missense probably damaging 0.98
R5354:Bcas1 UTSW 2 170349396 missense possibly damaging 0.94
R5686:Bcas1 UTSW 2 170406810 missense probably benign 0.03
R7566:Bcas1 UTSW 2 170370449 critical splice donor site probably null
R7736:Bcas1 UTSW 2 170387164 missense possibly damaging 0.89
R7816:Bcas1 UTSW 2 170406427 missense probably benign 0.11
R7850:Bcas1 UTSW 2 170348103 missense probably damaging 1.00
R8078:Bcas1 UTSW 2 170418612 missense possibly damaging 0.87
R8530:Bcas1 UTSW 2 170387948 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGATGTTTCTGCCTACGC -3'
(R):5'- GGCAGGCTCCAGATAAAACC -3'

Sequencing Primer
(F):5'- CTGCCTACGCGGAATGTAGTG -3'
(R):5'- GGCTCCAGATAAAACCCCAGGG -3'
Posted On2021-01-18