Incidental Mutation 'R8729:Galnt18'
ID 662651
Institutional Source Beutler Lab
Gene Symbol Galnt18
Ensembl Gene ENSMUSG00000038296
Gene Name polypeptide N-acetylgalactosaminyltransferase 18
Synonyms Galntl4, 2900011G21Rik
MMRRC Submission 068577-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8729 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 111471661-111779977 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111519991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 441 (E441G)
Ref Sequence ENSEMBL: ENSMUSP00000043636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049430] [ENSMUST00000106663]
AlphaFold Q8K1B9
Predicted Effect probably null
Transcript: ENSMUST00000049430
AA Change: E441G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043636
Gene: ENSMUSG00000038296
AA Change: E441G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 128 141 N/A INTRINSIC
Pfam:Glycos_transf_2 157 345 1.1e-25 PFAM
RICIN 485 614 8.3e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106663
AA Change: E426G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102274
Gene: ENSMUSG00000038296
AA Change: E426G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 128 141 N/A INTRINSIC
Pfam:Glycos_transf_2 157 344 1.4e-23 PFAM
RICIN 470 599 8.3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik C A 6: 116,651,801 P35H probably damaging Het
Adam4 A T 12: 81,421,402 Y148* probably null Het
Ank3 A G 10: 70,002,598 D1812G possibly damaging Het
Ankrd17 C T 5: 90,295,593 C405Y probably benign Het
Ankrd61 A G 5: 143,890,985 Y391H probably benign Het
Calcb A C 7: 114,720,193 E70A probably benign Het
Ccr1 T C 9: 123,963,794 K233R probably benign Het
Ccz1 T C 5: 144,011,492 D115G probably damaging Het
Col14a1 T A 15: 55,447,497 L1203* probably null Het
Csmd2 G A 4: 128,462,845 D1648N Het
Csn1s1 T C 5: 87,677,139 probably null Het
Eif2ak3 C A 6: 70,844,880 P52Q probably benign Het
Fam129b T A 2: 32,909,934 L91Q probably damaging Het
Gm21671 A G 5: 25,953,180 V58A probably damaging Het
Gpat2 C A 2: 127,433,819 Q506K probably damaging Het
Gramd1a C A 7: 31,143,823 R20L possibly damaging Het
Helz G T 11: 107,637,928 probably null Het
Hif1a A G 12: 73,944,128 N725D probably damaging Het
Ighv3-3 A T 12: 114,196,632 W53R possibly damaging Het
Kat2a T C 11: 100,710,511 K331R probably benign Het
Klk1b4 T A 7: 44,207,460 F3I probably damaging Het
Krt78 T G 15: 101,947,020 Q785H probably damaging Het
Lsm11 C T 11: 45,944,900 E5K possibly damaging Het
Luzp2 A G 7: 55,167,237 K145R probably damaging Het
Man2b2 T C 5: 36,816,118 T506A probably benign Het
Msrb3 A C 10: 120,852,069 C34G probably null Het
Muc16 T C 9: 18,660,050 D391G unknown Het
Mybpc2 C T 7: 44,506,187 V881M probably damaging Het
Myh15 A G 16: 49,061,488 K31R probably damaging Het
Ndnf A T 6: 65,703,774 K346* probably null Het
Nfs1 G A 2: 156,123,807 T118I probably benign Het
Nlrp9c T G 7: 26,372,003 K893N probably benign Het
Nmd3 A T 3: 69,748,349 K454N possibly damaging Het
Olfr290 T C 7: 84,916,315 C179R probably damaging Het
Pcdhb9 C A 18: 37,402,586 D544E possibly damaging Het
Pck1 A G 2: 173,156,073 I312V probably damaging Het
Pkd2l2 G A 18: 34,433,301 V522I probably benign Het
Polr3c C T 3: 96,727,480 probably benign Het
Prkd2 T A 7: 16,849,127 H271Q probably damaging Het
Rpp21 A G 17: 36,256,035 S59P probably benign Het
Rxfp4 T A 3: 88,651,998 N382I unknown Het
Sirt1 A G 10: 63,320,926 F642L probably damaging Het
Sp2 T C 11: 96,961,273 D275G possibly damaging Het
Srp72 C T 5: 76,994,158 T414I probably benign Het
Syne1 T A 10: 5,229,275 M4400L probably benign Het
Tbx15 A T 3: 99,313,060 H156L possibly damaging Het
Tbxas1 G T 6: 39,001,338 M140I probably benign Het
Tcof1 G T 18: 60,829,073 P695T unknown Het
Tmprss9 A T 10: 80,890,343 M476L probably benign Het
Trat1 A T 16: 48,742,228 I73N probably damaging Het
Trp53bp2 A T 1: 182,449,022 E856V probably benign Het
Ttc28 T A 5: 111,235,643 probably null Het
Ttn AC A 2: 76,919,184 probably null Het
Twf1 T C 15: 94,581,331 N216D probably benign Het
Unc80 C A 1: 66,608,490 H1530N probably benign Het
Vmn1r235 A T 17: 21,261,613 M67L probably benign Het
Vmn2r111 A T 17: 22,548,258 Y753N probably damaging Het
Zkscan5 T A 5: 145,220,261 N524K probably benign Het
Other mutations in Galnt18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Galnt18 APN 7 111471995 missense probably damaging 1.00
IGL03110:Galnt18 APN 7 111548713 missense probably benign 0.01
IGL03263:Galnt18 APN 7 111520114 missense probably damaging 1.00
R0013:Galnt18 UTSW 7 111554457 missense probably damaging 1.00
R0013:Galnt18 UTSW 7 111554457 missense probably damaging 1.00
R0141:Galnt18 UTSW 7 111599031 missense probably damaging 1.00
R0471:Galnt18 UTSW 7 111779299 splice site probably benign
R0494:Galnt18 UTSW 7 111554564 missense probably damaging 1.00
R0546:Galnt18 UTSW 7 111508141 missense probably damaging 1.00
R0682:Galnt18 UTSW 7 111520015 missense probably damaging 1.00
R0938:Galnt18 UTSW 7 111519999 missense possibly damaging 0.85
R1321:Galnt18 UTSW 7 111779432 missense probably benign 0.19
R1457:Galnt18 UTSW 7 111779428 nonsense probably null
R1656:Galnt18 UTSW 7 111616492 splice site probably benign
R2077:Galnt18 UTSW 7 111554602 missense probably damaging 1.00
R2567:Galnt18 UTSW 7 111554616 missense probably damaging 1.00
R3788:Galnt18 UTSW 7 111520115 nonsense probably null
R4835:Galnt18 UTSW 7 111779523 missense probably damaging 0.99
R4962:Galnt18 UTSW 7 111472064 missense probably benign 0.10
R6125:Galnt18 UTSW 7 111485193 missense probably damaging 0.96
R6216:Galnt18 UTSW 7 111513550 missense probably benign 0.39
R7075:Galnt18 UTSW 7 111556388 missense possibly damaging 0.63
R7831:Galnt18 UTSW 7 111556458 missense possibly damaging 0.79
R8728:Galnt18 UTSW 7 111520036 missense probably damaging 1.00
R8888:Galnt18 UTSW 7 111779502 missense possibly damaging 0.84
R8895:Galnt18 UTSW 7 111779502 missense possibly damaging 0.84
R9330:Galnt18 UTSW 7 111472064 missense probably benign 0.10
R9448:Galnt18 UTSW 7 111554442 missense probably damaging 1.00
R9746:Galnt18 UTSW 7 111471961 missense possibly damaging 0.90
RF017:Galnt18 UTSW 7 111599014 missense probably damaging 1.00
Z1177:Galnt18 UTSW 7 111485151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTGGAGGGAATGCACC -3'
(R):5'- TGCCTTTACAGGTATGGCAGTG -3'

Sequencing Primer
(F):5'- TTCCTCCGAGCATGGATGTAGATAAG -3'
(R):5'- GCAGTGTGGCGGGAGTG -3'
Posted On 2021-03-08