Incidental Mutation 'R8729:Nfs1'
ID662624
Institutional Source Beutler Lab
Gene Symbol Nfs1
Ensembl Gene ENSMUSG00000027618
Gene Namenitrogen fixation gene 1 (S. cerevisiae)
Synonymsm-Nfs1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R8729 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location156123639-156144186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156123807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 118 (T118I)
Ref Sequence ENSEMBL: ENSMUSP00000139294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029147] [ENSMUST00000184469]
Predicted Effect probably benign
Transcript: ENSMUST00000029147
SMART Domains Protein: ENSMUSP00000029147
Gene: ENSMUSG00000027618

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 424 6.2e-94 PFAM
Pfam:Beta_elim_lyase 94 344 7.8e-12 PFAM
Pfam:DegT_DnrJ_EryC1 100 250 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184469
AA Change: T118I

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139294
Gene: ENSMUSG00000027618
AA Change: T118I

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 81 2.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Iron-sulfur clusters are required for the function of many cellular enzymes. The proteins encoded by this gene supply inorganic sulfur to these clusters by removing the sulfur from cysteine, creating alanine in the process. This gene uses alternate in-frame translation initiation sites to generate mitochondrial forms and cytoplasmic/nuclear forms. Selection of the alternative initiation sites is determined by the cytosolic pH. The encoded proteins belong to the class-V family of pyridoxal phosphate-dependent aminotransferases. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik C A 6: 116,651,801 P35H probably damaging Het
Adam4 A T 12: 81,421,402 Y148* probably null Het
Ank3 A G 10: 70,002,598 D1812G possibly damaging Het
Ankrd17 C T 5: 90,295,593 C405Y probably benign Het
Ankrd61 A G 5: 143,890,985 Y391H probably benign Het
Calcb A C 7: 114,720,193 E70A probably benign Het
Ccr1 T C 9: 123,963,794 K233R probably benign Het
Ccz1 T C 5: 144,011,492 D115G probably damaging Het
Col14a1 T A 15: 55,447,497 L1203* probably null Het
Csmd2 G A 4: 128,462,845 D1648N Het
Csn1s1 T C 5: 87,677,139 probably null Het
Eif2ak3 C A 6: 70,844,880 P52Q probably benign Het
Fam129b T A 2: 32,909,934 L91Q probably damaging Het
Galnt18 T C 7: 111,519,991 E441G probably null Het
Gm21671 A G 5: 25,953,180 V58A probably damaging Het
Gpat2 C A 2: 127,433,819 Q506K probably damaging Het
Gramd1a C A 7: 31,143,823 R20L possibly damaging Het
Helz G T 11: 107,637,928 probably null Het
Hif1a A G 12: 73,944,128 N725D probably damaging Het
Ighv3-3 A T 12: 114,196,632 W53R possibly damaging Het
Kat2a T C 11: 100,710,511 K331R probably benign Het
Klk1b4 T A 7: 44,207,460 F3I probably damaging Het
Krt78 T G 15: 101,947,020 Q785H probably damaging Het
Lsm11 C T 11: 45,944,900 E5K possibly damaging Het
Luzp2 A G 7: 55,167,237 K145R probably damaging Het
Man2b2 T C 5: 36,816,118 T506A probably benign Het
Msrb3 A C 10: 120,852,069 C34G probably null Het
Muc16 T C 9: 18,660,050 D391G unknown Het
Mybpc2 C T 7: 44,506,187 V881M probably damaging Het
Myh15 A G 16: 49,061,488 K31R probably damaging Het
Ndnf A T 6: 65,703,774 K346* probably null Het
Nlrp9c T G 7: 26,372,003 K893N probably benign Het
Nmd3 A T 3: 69,748,349 K454N possibly damaging Het
Olfr290 T C 7: 84,916,315 C179R probably damaging Het
Pcdhb9 C A 18: 37,402,586 D544E possibly damaging Het
Pck1 A G 2: 173,156,073 I312V probably damaging Het
Pkd2l2 G A 18: 34,433,301 V522I probably benign Het
Polr3c C T 3: 96,727,480 probably benign Het
Prkd2 T A 7: 16,849,127 H271Q probably damaging Het
Rxfp4 T A 3: 88,651,998 N382I unknown Het
Sirt1 A G 10: 63,320,926 F642L probably damaging Het
Sp2 T C 11: 96,961,273 D275G possibly damaging Het
Srp72 C T 5: 76,994,158 T414I probably benign Het
Syne1 T A 10: 5,229,275 M4400L probably benign Het
Tbx15 A T 3: 99,313,060 H156L possibly damaging Het
Tbxas1 G T 6: 39,001,338 M140I probably benign Het
Tcof1 G T 18: 60,829,073 P695T unknown Het
Tmprss9 A T 10: 80,890,343 M476L probably benign Het
Trat1 A T 16: 48,742,228 I73N probably damaging Het
Trp53bp2 A T 1: 182,449,022 E856V probably benign Het
Ttc28 T A 5: 111,235,643 probably null Het
Ttn AC A 2: 76,919,184 probably null Het
Twf1 T C 15: 94,581,331 N216D probably benign Het
Unc80 C A 1: 66,608,490 H1530N probably benign Het
Vmn1r235 A T 17: 21,261,613 M67L probably benign Het
Vmn2r111 A T 17: 22,548,258 Y753N probably damaging Het
Zkscan5 T A 5: 145,220,261 N524K probably benign Het
Other mutations in Nfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Nfs1 APN 2 156124271 missense probably damaging 1.00
IGL02944:Nfs1 APN 2 156127768 missense probably damaging 1.00
IGL03350:Nfs1 APN 2 156127740 missense probably benign 0.37
lantana UTSW 2 156134449 missense possibly damaging 0.94
G1Funyon:Nfs1 UTSW 2 156134493 nonsense probably null
R0118:Nfs1 UTSW 2 156134524 missense probably damaging 1.00
R0374:Nfs1 UTSW 2 156132660 missense probably damaging 1.00
R1653:Nfs1 UTSW 2 156125336 missense probably damaging 1.00
R3787:Nfs1 UTSW 2 156128583 missense possibly damaging 0.53
R4614:Nfs1 UTSW 2 156144050 missense probably benign 0.04
R4782:Nfs1 UTSW 2 156134449 missense possibly damaging 0.94
R4799:Nfs1 UTSW 2 156134449 missense possibly damaging 0.94
R5053:Nfs1 UTSW 2 156126398 missense probably damaging 0.99
R5447:Nfs1 UTSW 2 156142136 missense probably benign 0.01
R5479:Nfs1 UTSW 2 156128502 missense probably damaging 1.00
R5992:Nfs1 UTSW 2 156134453 missense probably damaging 0.98
R7267:Nfs1 UTSW 2 156123783 missense probably benign 0.12
R7400:Nfs1 UTSW 2 156126323 missense probably damaging 1.00
R7886:Nfs1 UTSW 2 156142061 missense unknown
R8301:Nfs1 UTSW 2 156134493 nonsense probably null
R8905:Nfs1 UTSW 2 156128583 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGCAGAGTTCTCTCCAGATG -3'
(R):5'- CTTGTTACTGCCACAGGGAG -3'

Sequencing Primer
(F):5'- TCTCCAGATGCTCAAAAATTCAAGG -3'
(R):5'- GGACCTACCTGTGCAGAGATG -3'
Posted On2021-03-08