Incidental Mutation 'R8729:Pkd2l2'
ID662674
Institutional Source Beutler Lab
Gene Symbol Pkd2l2
Ensembl Gene ENSMUSG00000014503
Gene Namepolycystic kidney disease 2-like 2
SynonymsTRPP5, Polycystin - L2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8729 (G1)
Quality Score127.008
Status Not validated
Chromosome18
Chromosomal Location34409423-34442789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34433301 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 522 (V522I)
Ref Sequence ENSEMBL: ENSMUSP00000014647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014647] [ENSMUST00000166156]
Predicted Effect probably benign
Transcript: ENSMUST00000014647
AA Change: V522I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014647
Gene: ENSMUSG00000014503
AA Change: V522I

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.8e-129 PFAM
Pfam:Ion_trans 281 490 4.1e-19 PFAM
coiled coil region 523 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166156
AA Change: V522I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127257
Gene: ENSMUSG00000014503
AA Change: V522I

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.6e-131 PFAM
Pfam:Ion_trans 242 502 4.8e-20 PFAM
coiled coil region 523 550 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted gene disruption display hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik C A 6: 116,651,801 P35H probably damaging Het
Adam4 A T 12: 81,421,402 Y148* probably null Het
Ank3 A G 10: 70,002,598 D1812G possibly damaging Het
Ankrd17 C T 5: 90,295,593 C405Y probably benign Het
Ankrd61 A G 5: 143,890,985 Y391H probably benign Het
Calcb A C 7: 114,720,193 E70A probably benign Het
Ccr1 T C 9: 123,963,794 K233R probably benign Het
Ccz1 T C 5: 144,011,492 D115G probably damaging Het
Col14a1 T A 15: 55,447,497 L1203* probably null Het
Csmd2 G A 4: 128,462,845 D1648N Het
Csn1s1 T C 5: 87,677,139 probably null Het
Eif2ak3 C A 6: 70,844,880 P52Q probably benign Het
Fam129b T A 2: 32,909,934 L91Q probably damaging Het
Galnt18 T C 7: 111,519,991 E441G probably null Het
Gm21671 A G 5: 25,953,180 V58A probably damaging Het
Gpat2 C A 2: 127,433,819 Q506K probably damaging Het
Gramd1a C A 7: 31,143,823 R20L possibly damaging Het
Helz G T 11: 107,637,928 probably null Het
Hif1a A G 12: 73,944,128 N725D probably damaging Het
Ighv3-3 A T 12: 114,196,632 W53R possibly damaging Het
Kat2a T C 11: 100,710,511 K331R probably benign Het
Klk1b4 T A 7: 44,207,460 F3I probably damaging Het
Krt78 T G 15: 101,947,020 Q785H probably damaging Het
Lsm11 C T 11: 45,944,900 E5K possibly damaging Het
Luzp2 A G 7: 55,167,237 K145R probably damaging Het
Man2b2 T C 5: 36,816,118 T506A probably benign Het
Msrb3 A C 10: 120,852,069 C34G probably null Het
Muc16 T C 9: 18,660,050 D391G unknown Het
Mybpc2 C T 7: 44,506,187 V881M probably damaging Het
Myh15 A G 16: 49,061,488 K31R probably damaging Het
Ndnf A T 6: 65,703,774 K346* probably null Het
Nfs1 G A 2: 156,123,807 T118I probably benign Het
Nlrp9c T G 7: 26,372,003 K893N probably benign Het
Nmd3 A T 3: 69,748,349 K454N possibly damaging Het
Olfr290 T C 7: 84,916,315 C179R probably damaging Het
Pcdhb9 C A 18: 37,402,586 D544E possibly damaging Het
Pck1 A G 2: 173,156,073 I312V probably damaging Het
Polr3c C T 3: 96,727,480 probably benign Het
Prkd2 T A 7: 16,849,127 H271Q probably damaging Het
Rxfp4 T A 3: 88,651,998 N382I unknown Het
Sirt1 A G 10: 63,320,926 F642L probably damaging Het
Sp2 T C 11: 96,961,273 D275G possibly damaging Het
Srp72 C T 5: 76,994,158 T414I probably benign Het
Syne1 T A 10: 5,229,275 M4400L probably benign Het
Tbx15 A T 3: 99,313,060 H156L possibly damaging Het
Tbxas1 G T 6: 39,001,338 M140I probably benign Het
Tcof1 G T 18: 60,829,073 P695T unknown Het
Tmprss9 A T 10: 80,890,343 M476L probably benign Het
Trat1 A T 16: 48,742,228 I73N probably damaging Het
Trp53bp2 A T 1: 182,449,022 E856V probably benign Het
Ttc28 T A 5: 111,235,643 probably null Het
Ttn AC A 2: 76,919,184 probably null Het
Twf1 T C 15: 94,581,331 N216D probably benign Het
Unc80 C A 1: 66,608,490 H1530N probably benign Het
Vmn1r235 A T 17: 21,261,613 M67L probably benign Het
Vmn2r111 A T 17: 22,548,258 Y753N probably damaging Het
Zkscan5 T A 5: 145,220,261 N524K probably benign Het
Other mutations in Pkd2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Pkd2l2 APN 18 34417015 missense probably damaging 1.00
IGL01943:Pkd2l2 APN 18 34417036 missense probably damaging 1.00
IGL02039:Pkd2l2 APN 18 34435368 critical splice donor site probably null
IGL02139:Pkd2l2 APN 18 34412715 nonsense probably null
IGL02480:Pkd2l2 APN 18 34438790 missense possibly damaging 0.48
IGL02742:Pkd2l2 APN 18 34416917 nonsense probably null
IGL02818:Pkd2l2 APN 18 34412809 missense probably damaging 0.97
IGL03218:Pkd2l2 APN 18 34430320 missense probably damaging 1.00
IGL03345:Pkd2l2 APN 18 34425089 missense probably damaging 1.00
R0362:Pkd2l2 UTSW 18 34435327 missense probably benign 0.03
R0627:Pkd2l2 UTSW 18 34425102 missense probably damaging 1.00
R0883:Pkd2l2 UTSW 18 34430268 splice site probably null
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0973:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R0974:Pkd2l2 UTSW 18 34428252 missense probably damaging 1.00
R1199:Pkd2l2 UTSW 18 34438216 critical splice donor site probably null
R1529:Pkd2l2 UTSW 18 34430702 missense probably damaging 1.00
R1579:Pkd2l2 UTSW 18 34427393 missense possibly damaging 0.49
R2229:Pkd2l2 UTSW 18 34430329 missense probably damaging 1.00
R3695:Pkd2l2 UTSW 18 34438790 missense possibly damaging 0.48
R4058:Pkd2l2 UTSW 18 34428192 missense probably benign 0.22
R4600:Pkd2l2 UTSW 18 34438201 missense probably benign 0.03
R4651:Pkd2l2 UTSW 18 34409836 nonsense probably null
R4652:Pkd2l2 UTSW 18 34409836 nonsense probably null
R5114:Pkd2l2 UTSW 18 34433302 missense probably benign
R5341:Pkd2l2 UTSW 18 34409934 splice site probably null
R5686:Pkd2l2 UTSW 18 34425237 missense probably damaging 1.00
R5920:Pkd2l2 UTSW 18 34430773 missense probably benign
R6061:Pkd2l2 UTSW 18 34430689 missense probably damaging 1.00
R6167:Pkd2l2 UTSW 18 34428244 missense probably damaging 1.00
R6217:Pkd2l2 UTSW 18 34414680 missense probably benign 0.03
R6293:Pkd2l2 UTSW 18 34427444 missense probably damaging 1.00
R6572:Pkd2l2 UTSW 18 34438771 missense probably damaging 0.99
R6574:Pkd2l2 UTSW 18 34425081 missense probably damaging 1.00
R6723:Pkd2l2 UTSW 18 34438157 missense probably damaging 0.98
R6941:Pkd2l2 UTSW 18 34416883 missense probably benign 0.02
R6958:Pkd2l2 UTSW 18 34409490 nonsense probably null
R7052:Pkd2l2 UTSW 18 34425159 missense possibly damaging 0.90
R7695:Pkd2l2 UTSW 18 34428245 missense possibly damaging 0.77
R7763:Pkd2l2 UTSW 18 34433287 critical splice acceptor site probably null
R7777:Pkd2l2 UTSW 18 34416860 missense probably damaging 1.00
R7944:Pkd2l2 UTSW 18 34427428 missense possibly damaging 0.90
R8003:Pkd2l2 UTSW 18 34428179 missense probably damaging 1.00
R8468:Pkd2l2 UTSW 18 34427411 missense possibly damaging 0.88
R8482:Pkd2l2 UTSW 18 34425113 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTTCATAAAGGCACAGTGAGAGGA -3'
(R):5'- CTGCTAACCCTGTCCTAAGTTG -3'

Sequencing Primer
(F):5'- TAGGCAGGAGTCCTTACA -3'
(R):5'- GATGTTCTTTACAGAATTTGCAA -3'
Posted On2021-03-08