Incidental Mutation 'R8711:Laptm4b'
ID 669603
Institutional Source Beutler Lab
Gene Symbol Laptm4b
Ensembl Gene ENSMUSG00000022257
Gene Name lysosomal-associated protein transmembrane 4B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R8711 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34238028-34284302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34277502 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 193 (V193E)
Ref Sequence ENSEMBL: ENSMUSP00000022867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022867] [ENSMUST00000226437] [ENSMUST00000226627]
AlphaFold Q91XQ6
Predicted Effect probably damaging
Transcript: ENSMUST00000022867
AA Change: V193E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022867
Gene: ENSMUSG00000022257
AA Change: V193E

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Mtp 139 226 6.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226437
Predicted Effect probably benign
Transcript: ENSMUST00000226627
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,516,086 S122T probably benign Het
Abcb11 G A 2: 69,265,512 T828I probably damaging Het
Atp5b T A 10: 128,085,500 N222K probably damaging Het
C1qbp T C 11: 70,978,487 T211A probably benign Het
Ccdc85a A T 11: 28,434,146 S410T possibly damaging Het
Chd4 T A 6: 125,123,522 probably benign Het
Col10a1 G T 10: 34,394,828 K265N probably damaging Het
Cyp2j5 A T 4: 96,641,423 M237K possibly damaging Het
Cyp4f40 T C 17: 32,675,988 probably benign Het
Cytip A T 2: 58,151,123 F90L probably damaging Het
Dnah7b A G 1: 46,175,438 D1121G probably damaging Het
Dohh G T 10: 81,386,025 E84D probably benign Het
Eif4g2 T C 7: 111,073,920 Y855C probably damaging Het
Ell T A 8: 70,581,681 probably benign Het
Ermap T C 4: 119,187,158 Y147C probably damaging Het
Fasn T C 11: 120,819,118 D371G possibly damaging Het
Fat2 A G 11: 55,268,303 S3348P probably benign Het
Fhad1 T A 4: 141,957,613 N472Y probably benign Het
Flad1 A G 3: 89,409,108 V49A probably damaging Het
Fpr-rs3 T C 17: 20,624,292 T196A probably benign Het
Fsip2 A G 2: 82,984,902 N3660D possibly damaging Het
Gabrp T A 11: 33,555,023 L259F probably damaging Het
Gm11639 A G 11: 104,852,545 I2187V probably benign Het
Gm16686 A T 4: 88,755,236 W119R unknown Het
Gm17660 G A 5: 104,072,090 T78I unknown Het
Gm21319 T A 12: 87,773,360 D143V unknown Het
Gng2 C T 14: 19,891,370 M1I probably null Het
Hmgxb3 T C 18: 61,157,649 N384S probably benign Het
Ibtk T C 9: 85,724,155 I440V probably benign Het
Il11ra1 A G 4: 41,767,539 D297G probably damaging Het
Irf2bpl T C 12: 86,881,722 I726V probably benign Het
Klk1b5 A G 7: 44,218,572 N56S probably benign Het
Lrrc37a A T 11: 103,497,524 C2358* probably null Het
Ltbp2 C T 12: 84,853,741 S269N probably benign Het
Morc2a T G 11: 3,680,013 Y450D probably damaging Het
Mycbp2 A T 14: 103,169,994 I2740K probably benign Het
Naif1 T A 2: 32,454,836 V184E probably damaging Het
Neurl1b T C 17: 26,441,773 V540A probably damaging Het
Nt5c1b T A 12: 10,381,450 F451Y probably damaging Het
Obox3 A G 7: 15,626,223 S174P probably benign Het
Obscn T C 11: 59,061,068 E3953G probably damaging Het
Olfr1180 A T 2: 88,412,251 C136S probably damaging Het
Olfr1247 A C 2: 89,609,947 S52A probably benign Het
Pkd1l1 G A 11: 8,865,550 H1904Y Het
Plec C T 15: 76,175,331 D3469N probably benign Het
Polr1b A G 2: 129,101,144 T20A probably damaging Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Prkce T A 17: 86,488,197 N287K probably damaging Het
Rchy1 C A 5: 91,957,538 C108F probably damaging Het
Sema6d A G 2: 124,660,312 Y572C possibly damaging Het
Sh3rf1 T A 8: 61,329,996 I248K probably damaging Het
Sin3b T C 8: 72,723,398 L30P probably damaging Het
Slc25a47 G A 12: 108,854,387 G106S probably damaging Het
Slc43a2 A C 11: 75,567,053 M385L probably benign Het
Slc43a3 A G 2: 84,938,327 T97A probably damaging Het
Slc9b2 T A 3: 135,324,590 S223T probably benign Het
Smc5 A T 19: 23,265,694 C118S probably damaging Het
Smpdl3b T C 4: 132,745,180 D94G probably damaging Het
Spred3 A G 7: 29,166,661 V71A possibly damaging Het
Srsf5 T A 12: 80,947,554 S86T possibly damaging Het
Sycp2 A G 2: 178,348,295 V1386A probably benign Het
Syne2 T C 12: 76,057,484 L743P probably damaging Het
Synj1 A G 16: 91,010,083 V62A probably damaging Het
Tbc1d9b T C 11: 50,156,751 L637P probably damaging Het
Tcf12 T G 9: 71,849,815 S697R possibly damaging Het
Tnfrsf11b T A 15: 54,260,112 Y31F possibly damaging Het
Trav5n-4 T C 14: 53,312,905 M1T probably null Het
Trbv13-2 A G 6: 41,121,782 E97G probably benign Het
Trpa1 G A 1: 14,910,774 P135S probably damaging Het
Ugt1a6a A C 1: 88,138,868 D132A possibly damaging Het
Vmn2r8 A T 5: 108,798,096 D548E possibly damaging Het
Zbtb39 A T 10: 127,742,946 D463V probably damaging Het
Zc3h12c C T 9: 52,126,558 probably benign Het
Zfp952 C T 17: 33,003,030 P161L possibly damaging Het
Other mutations in Laptm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Laptm4b APN 15 34258742 missense probably benign 0.01
IGL02638:Laptm4b APN 15 34277484 missense probably benign 0.06
R0609:Laptm4b UTSW 15 34258689 missense probably damaging 1.00
R2140:Laptm4b UTSW 15 34238332 missense probably benign 0.10
R2142:Laptm4b UTSW 15 34238332 missense probably benign 0.10
R5907:Laptm4b UTSW 15 34258684 missense possibly damaging 0.59
R6275:Laptm4b UTSW 15 34283327 missense probably benign 0.12
R7749:Laptm4b UTSW 15 34276200 missense probably benign 0.21
R8208:Laptm4b UTSW 15 34277445 missense probably damaging 1.00
R8755:Laptm4b UTSW 15 34273274 missense probably damaging 1.00
R8770:Laptm4b UTSW 15 34258697 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAATACATATAGTACTGCAACATGCA -3'
(R):5'- AAACATGACTTGGCCAGGC -3'

Sequencing Primer
(F):5'- CTTGCAGGGCTACTTGAT -3'
(R):5'- GTGGCAGACACTTTTAATCCCAG -3'
Posted On 2021-04-30